Incidental Mutation 'R8413:Tnks1bp1'
ID 652770
Institutional Source Beutler Lab
Gene Symbol Tnks1bp1
Ensembl Gene ENSMUSG00000033955
Gene Name tankyrase 1 binding protein 1
Synonyms TAB182
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8413 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 85048022-85073048 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 85062278 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 850 (S850P)
Ref Sequence ENSEMBL: ENSMUSP00000107232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048400] [ENSMUST00000111605]
AlphaFold P58871
Predicted Effect probably damaging
Transcript: ENSMUST00000048400
AA Change: S188P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045767
Gene: ENSMUSG00000033955
AA Change: S188P

DomainStartEndE-ValueType
low complexity region 77 96 N/A INTRINSIC
low complexity region 292 298 N/A INTRINSIC
low complexity region 809 827 N/A INTRINSIC
low complexity region 868 875 N/A INTRINSIC
Tankyrase_bdg_C 883 1055 1.98e-79 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111605
AA Change: S850P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107232
Gene: ENSMUSG00000033955
AA Change: S850P

DomainStartEndE-ValueType
low complexity region 37 44 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
low complexity region 296 316 N/A INTRINSIC
low complexity region 380 391 N/A INTRINSIC
low complexity region 496 518 N/A INTRINSIC
low complexity region 739 758 N/A INTRINSIC
low complexity region 954 960 N/A INTRINSIC
low complexity region 1471 1489 N/A INTRINSIC
low complexity region 1530 1537 N/A INTRINSIC
Tankyrase_bdg_C 1545 1717 1.98e-79 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T A 7: 120,423,900 D86E probably benign Het
Adamts5 A G 16: 85,866,618 probably null Het
Arhgap31 T C 16: 38,602,921 R928G possibly damaging Het
Birc6 T C 17: 74,546,393 V164A possibly damaging Het
Cdh26 T A 2: 178,468,229 H438Q probably damaging Het
Cfap65 T A 1: 74,917,169 K1084* probably null Het
Csmd1 T C 8: 15,900,676 H3511R probably damaging Het
Ebf1 T A 11: 44,643,447 S178T possibly damaging Het
Eln A G 5: 134,726,521 V226A unknown Het
Fat4 A T 3: 39,008,979 probably null Het
Gcn1l1 C T 5: 115,579,639 T222I probably benign Het
Gm11639 A C 11: 104,920,309 K3192N unknown Het
Gm5624 T G 14: 44,561,890 N70T Het
Gpc6 T A 14: 117,892,349 V387E possibly damaging Het
Gyg C T 3: 20,125,455 V255M probably damaging Het
Henmt1 T A 3: 108,957,649 F146I probably damaging Het
Itpr3 T A 17: 27,111,926 L1736Q probably damaging Het
Kcnh4 A G 11: 100,749,793 V469A possibly damaging Het
Mybpc2 A G 7: 44,508,305 L750P probably damaging Het
Naalad2 A G 9: 18,330,643 V655A probably damaging Het
Nme8 C T 13: 19,674,519 D289N probably benign Het
Olfr1109 T C 2: 87,093,158 K80E probably benign Het
Olfr1199 T A 2: 88,756,680 probably benign Het
Olfr358 T G 2: 37,005,390 T75P probably damaging Het
Olfr720 A G 14: 14,175,416 V222A probably benign Het
Olfr727 C G 14: 50,127,370 S264R probably benign Het
Olfr948 T A 9: 39,319,105 K170* probably null Het
Phf24 T A 4: 42,937,906 C173* probably null Het
Plcb2 A G 2: 118,718,823 F353L probably damaging Het
Prss33 C A 17: 23,833,956 W248L probably damaging Het
Rgs3 T G 4: 62,626,017 L350R possibly damaging Het
Samd11 C T 4: 156,249,273 G200D probably damaging Het
Sh3tc2 T A 18: 61,990,802 V878E probably damaging Het
Sh3tc2 G C 18: 62,015,071 G1284A probably benign Het
Skint5 A G 4: 113,715,703 S780P unknown Het
Slc8a3 T C 12: 81,314,678 K456E probably damaging Het
Smok2a T A 17: 13,225,612 H25Q probably benign Het
Srrt A G 5: 137,300,327 L225P possibly damaging Het
Stox1 C T 10: 62,664,975 R602Q probably damaging Het
Tmem30a A T 9: 79,776,225 C157S probably damaging Het
Trpm6 A G 19: 18,832,485 I1082V probably benign Het
Ttll5 T A 12: 85,919,121 N646K probably benign Het
Vmn1r179 A T 7: 23,928,852 Y156F probably benign Het
Vmn1r54 T A 6: 90,269,431 L109H probably damaging Het
Wdr17 T C 8: 54,662,918 I617V probably benign Het
Zeb2 T A 2: 44,996,171 Q958L probably damaging Het
Other mutations in Tnks1bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Tnks1bp1 APN 2 85062236 nonsense probably null
IGL00974:Tnks1bp1 APN 2 85062882 missense possibly damaging 0.86
IGL01874:Tnks1bp1 APN 2 85058447 missense probably benign 0.01
IGL02419:Tnks1bp1 APN 2 85071781 missense possibly damaging 0.60
IGL02441:Tnks1bp1 APN 2 85071799 missense probably damaging 1.00
IGL02475:Tnks1bp1 APN 2 85059377 missense probably damaging 1.00
IGL03181:Tnks1bp1 APN 2 85062714 missense probably benign 0.00
K3955:Tnks1bp1 UTSW 2 85062411 missense probably benign 0.01
P0038:Tnks1bp1 UTSW 2 85062411 missense probably benign 0.01
PIT4791001:Tnks1bp1 UTSW 2 85062558 missense probably benign 0.03
R0068:Tnks1bp1 UTSW 2 85062352 missense probably benign 0.12
R0068:Tnks1bp1 UTSW 2 85062352 missense probably benign 0.12
R0164:Tnks1bp1 UTSW 2 85059221 missense possibly damaging 0.94
R0164:Tnks1bp1 UTSW 2 85059221 missense possibly damaging 0.94
R0189:Tnks1bp1 UTSW 2 85070929 missense possibly damaging 0.77
R0454:Tnks1bp1 UTSW 2 85072137 missense probably damaging 1.00
R0650:Tnks1bp1 UTSW 2 85062630 missense possibly damaging 0.68
R0737:Tnks1bp1 UTSW 2 85052536 missense possibly damaging 0.93
R1718:Tnks1bp1 UTSW 2 85071738 missense probably benign 0.44
R1749:Tnks1bp1 UTSW 2 85063067 missense probably benign
R2194:Tnks1bp1 UTSW 2 85063065 missense probably benign 0.06
R2314:Tnks1bp1 UTSW 2 85058915 missense probably benign 0.01
R2379:Tnks1bp1 UTSW 2 85063838 missense probably benign 0.16
R3056:Tnks1bp1 UTSW 2 85070000 nonsense probably null
R3433:Tnks1bp1 UTSW 2 85071016 splice site probably benign
R3751:Tnks1bp1 UTSW 2 85058722 start gained probably benign
R4502:Tnks1bp1 UTSW 2 85062647 nonsense probably null
R4694:Tnks1bp1 UTSW 2 85071722 missense probably damaging 1.00
R4785:Tnks1bp1 UTSW 2 85063034 missense probably damaging 1.00
R5079:Tnks1bp1 UTSW 2 85062626 missense probably damaging 1.00
R5208:Tnks1bp1 UTSW 2 85070632 missense probably damaging 0.96
R5265:Tnks1bp1 UTSW 2 85062754 missense probably benign 0.01
R5512:Tnks1bp1 UTSW 2 85062834 missense probably benign 0.00
R5557:Tnks1bp1 UTSW 2 85063800 missense probably damaging 0.97
R6016:Tnks1bp1 UTSW 2 85052390 missense probably damaging 1.00
R6177:Tnks1bp1 UTSW 2 85059280 start gained probably benign
R6516:Tnks1bp1 UTSW 2 85070727 missense probably damaging 0.97
R6517:Tnks1bp1 UTSW 2 85059345 missense probably benign 0.00
R7032:Tnks1bp1 UTSW 2 85061953 missense probably benign 0.00
R7120:Tnks1bp1 UTSW 2 85072097 missense probably damaging 1.00
R7302:Tnks1bp1 UTSW 2 85052354 missense probably benign 0.24
R7393:Tnks1bp1 UTSW 2 85062866 missense probably benign
R7535:Tnks1bp1 UTSW 2 85063280 nonsense probably null
R7596:Tnks1bp1 UTSW 2 85062713 missense probably benign 0.14
R7680:Tnks1bp1 UTSW 2 85059241 missense probably benign 0.36
R8345:Tnks1bp1 UTSW 2 85062882 missense possibly damaging 0.86
R8768:Tnks1bp1 UTSW 2 85070636 nonsense probably null
R8936:Tnks1bp1 UTSW 2 85063976 missense probably benign 0.00
R8991:Tnks1bp1 UTSW 2 85063946 missense probably benign 0.00
R9007:Tnks1bp1 UTSW 2 85070704 missense probably damaging 1.00
R9118:Tnks1bp1 UTSW 2 85063376 missense probably damaging 1.00
Z1176:Tnks1bp1 UTSW 2 85063530 missense probably damaging 0.99
Z1177:Tnks1bp1 UTSW 2 85059003 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAGAACTATAGCCTCGGGG -3'
(R):5'- AGCCACGAGAGAGGTTCTTC -3'

Sequencing Primer
(F):5'- CCGTTGGAGACACAGGTC -3'
(R):5'- ACGAGAGAGGTTCTTCATCCC -3'
Posted On 2020-10-20