Incidental Mutation 'R8413:Olfr1109'
ID652771
Institutional Source Beutler Lab
Gene Symbol Olfr1109
Ensembl Gene ENSMUSG00000075161
Gene Nameolfactory receptor 1109
SynonymsMOR172-5, GA_x6K02T2Q125-48586461-48585523
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R8413 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location87091195-87096008 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87093158 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 80 (K80E)
Ref Sequence ENSEMBL: ENSMUSP00000150159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099863] [ENSMUST00000214636] [ENSMUST00000217066]
Predicted Effect probably benign
Transcript: ENSMUST00000099863
AA Change: K80E

PolyPhen 2 Score 0.247 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000097449
Gene: ENSMUSG00000075161
AA Change: K80E

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 8.3e-52 PFAM
Pfam:7tm_1 41 290 6.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214636
AA Change: K80E

PolyPhen 2 Score 0.247 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000217066
AA Change: K80E

PolyPhen 2 Score 0.247 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T A 7: 120,423,900 D86E probably benign Het
Adamts5 A G 16: 85,866,618 probably null Het
Arhgap31 T C 16: 38,602,921 R928G possibly damaging Het
Birc6 T C 17: 74,546,393 V164A possibly damaging Het
Cdh26 T A 2: 178,468,229 H438Q probably damaging Het
Cfap65 T A 1: 74,917,169 K1084* probably null Het
Csmd1 T C 8: 15,900,676 H3511R probably damaging Het
Ebf1 T A 11: 44,643,447 S178T possibly damaging Het
Eln A G 5: 134,726,521 V226A unknown Het
Fat4 A T 3: 39,008,979 probably null Het
Gcn1l1 C T 5: 115,579,639 T222I probably benign Het
Gm11639 A C 11: 104,920,309 K3192N unknown Het
Gm5624 T G 14: 44,561,890 N70T Het
Gpc6 T A 14: 117,892,349 V387E possibly damaging Het
Gyg C T 3: 20,125,455 V255M probably damaging Het
Henmt1 T A 3: 108,957,649 F146I probably damaging Het
Itpr3 T A 17: 27,111,926 L1736Q probably damaging Het
Kcnh4 A G 11: 100,749,793 V469A possibly damaging Het
Mybpc2 A G 7: 44,508,305 L750P probably damaging Het
Naalad2 A G 9: 18,330,643 V655A probably damaging Het
Nme8 C T 13: 19,674,519 D289N probably benign Het
Olfr1199 T A 2: 88,756,680 probably benign Het
Olfr358 T G 2: 37,005,390 T75P probably damaging Het
Olfr720 A G 14: 14,175,416 V222A probably benign Het
Olfr727 C G 14: 50,127,370 S264R probably benign Het
Olfr948 T A 9: 39,319,105 K170* probably null Het
Phf24 T A 4: 42,937,906 C173* probably null Het
Plcb2 A G 2: 118,718,823 F353L probably damaging Het
Prss33 C A 17: 23,833,956 W248L probably damaging Het
Rgs3 T G 4: 62,626,017 L350R possibly damaging Het
Samd11 C T 4: 156,249,273 G200D probably damaging Het
Sh3tc2 T A 18: 61,990,802 V878E probably damaging Het
Sh3tc2 G C 18: 62,015,071 G1284A probably benign Het
Skint5 A G 4: 113,715,703 S780P unknown Het
Slc8a3 T C 12: 81,314,678 K456E probably damaging Het
Smok2a T A 17: 13,225,612 H25Q probably benign Het
Srrt A G 5: 137,300,327 L225P possibly damaging Het
Stox1 C T 10: 62,664,975 R602Q probably damaging Het
Tmem30a A T 9: 79,776,225 C157S probably damaging Het
Tnks1bp1 T C 2: 85,062,278 S850P probably damaging Het
Trpm6 A G 19: 18,832,485 I1082V probably benign Het
Ttll5 T A 12: 85,919,121 N646K probably benign Het
Vmn1r179 A T 7: 23,928,852 Y156F probably benign Het
Vmn1r54 T A 6: 90,269,431 L109H probably damaging Het
Wdr17 T C 8: 54,662,918 I617V probably benign Het
Zeb2 T A 2: 44,996,171 Q958L probably damaging Het
Other mutations in Olfr1109
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01341:Olfr1109 APN 2 87093299 missense probably benign
IGL01926:Olfr1109 APN 2 87092974 missense probably damaging 1.00
IGL03195:Olfr1109 APN 2 87092569 missense probably damaging 1.00
R0550:Olfr1109 UTSW 2 87093129 missense probably benign 0.00
R1334:Olfr1109 UTSW 2 87093227 missense probably damaging 0.98
R1677:Olfr1109 UTSW 2 87092737 missense probably benign
R1753:Olfr1109 UTSW 2 87093227 missense probably damaging 0.98
R3933:Olfr1109 UTSW 2 87092762 missense probably benign 0.01
R4151:Olfr1109 UTSW 2 87093170 missense probably benign 0.07
R4296:Olfr1109 UTSW 2 87092630 missense probably benign 0.00
R6654:Olfr1109 UTSW 2 87093050 missense probably benign 0.23
R6657:Olfr1109 UTSW 2 87093059 missense probably benign 0.00
R7697:Olfr1109 UTSW 2 87092818 missense probably benign 0.30
R8178:Olfr1109 UTSW 2 87092876 missense possibly damaging 0.94
Z1176:Olfr1109 UTSW 2 87093224 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- ATGATGCCACACAAGTAACATG -3'
(R):5'- TCCCGATTGGCAGATTCCTC -3'

Sequencing Primer
(F):5'- GAACCATGCTAATACAGATGCTG -3'
(R):5'- GATTGGCAGATTCCTCTCTTTTTG -3'
Posted On2020-10-20