Incidental Mutation 'R8413:Plcb2'
ID 652773
Institutional Source Beutler Lab
Gene Symbol Plcb2
Ensembl Gene ENSMUSG00000040061
Gene Name phospholipase C, beta 2
Synonyms B230205M18Rik
MMRRC Submission 067767-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8413 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 118537998-118558919 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 118549304 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 353 (F353L)
Ref Sequence ENSEMBL: ENSMUSP00000124364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102524] [ENSMUST00000159756]
AlphaFold A3KGF7
Predicted Effect probably damaging
Transcript: ENSMUST00000102524
AA Change: F376L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099583
Gene: ENSMUSG00000040061
AA Change: F376L

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:EF-hand_like 220 311 2.5e-24 PFAM
PLCXc 312 463 2.87e-79 SMART
low complexity region 504 518 N/A INTRINSIC
PLCYc 547 663 2.39e-67 SMART
C2 684 783 9.17e-15 SMART
low complexity region 902 925 N/A INTRINSIC
low complexity region 929 940 N/A INTRINSIC
Pfam:PLC-beta_C 974 1149 4.7e-72 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159756
AA Change: F353L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124364
Gene: ENSMUSG00000040061
AA Change: F353L

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:EF-hand_like 197 288 7.1e-26 PFAM
PLCXc 289 440 2.87e-79 SMART
low complexity region 481 495 N/A INTRINSIC
PLCYc 524 640 2.39e-67 SMART
C2 661 760 9.17e-15 SMART
low complexity region 879 902 N/A INTRINSIC
low complexity region 906 917 N/A INTRINSIC
Pfam:PLC-beta_C 946 1129 5.1e-68 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a phosphodiesterase that catalyzes the hydrolysis of phosphatidylinositol 4,5-bisphosphate to the second messengers inositol 1,4,5-trisphosphate (IP3) and diacylglycerol. The encoded protein is activated by G proteins and has been shown to be involved in the type 2 taste receptor signal transduction pathway. In addition, nuclear factor kappa B can regulate the transcription of this gene, whose protein product is also an important regulator of platelet responses. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygous mutant mice showed an increased sensitivity to both bacterial and viral infections and exhibited abnormal taste perception in which sweet, umami, and bitter stimuli could not be sensed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T A 7: 120,023,123 (GRCm39) D86E probably benign Het
Adamts5 A G 16: 85,663,506 (GRCm39) probably null Het
Arhgap31 T C 16: 38,423,283 (GRCm39) R928G possibly damaging Het
Birc6 T C 17: 74,853,388 (GRCm39) V164A possibly damaging Het
Cdh26 T A 2: 178,110,022 (GRCm39) H438Q probably damaging Het
Cfap65 T A 1: 74,956,328 (GRCm39) K1084* probably null Het
Csmd1 T C 8: 15,950,676 (GRCm39) H3511R probably damaging Het
Ebf1 T A 11: 44,534,274 (GRCm39) S178T possibly damaging Het
Efcab3 A C 11: 104,811,135 (GRCm39) K3192N unknown Het
Eln A G 5: 134,755,375 (GRCm39) V226A unknown Het
Fat4 A T 3: 39,063,128 (GRCm39) probably null Het
Gcn1 C T 5: 115,717,698 (GRCm39) T222I probably benign Het
Gm5624 T G 14: 44,799,347 (GRCm39) N70T Het
Gpc6 T A 14: 118,129,761 (GRCm39) V387E possibly damaging Het
Gyg1 C T 3: 20,179,619 (GRCm39) V255M probably damaging Het
Henmt1 T A 3: 108,864,965 (GRCm39) F146I probably damaging Het
Itpr3 T A 17: 27,330,900 (GRCm39) L1736Q probably damaging Het
Kcnh4 A G 11: 100,640,619 (GRCm39) V469A possibly damaging Het
Mybpc2 A G 7: 44,157,729 (GRCm39) L750P probably damaging Het
Naalad2 A G 9: 18,241,939 (GRCm39) V655A probably damaging Het
Nme8 C T 13: 19,858,689 (GRCm39) D289N probably benign Het
Or12k5 T G 2: 36,895,402 (GRCm39) T75P probably damaging Het
Or2t6 A G 14: 14,175,416 (GRCm38) V222A probably benign Het
Or4c104 T A 2: 88,587,024 (GRCm39) probably benign Het
Or4k15 C G 14: 50,364,827 (GRCm39) S264R probably benign Het
Or5aq6 T C 2: 86,923,502 (GRCm39) K80E probably benign Het
Or8g30 T A 9: 39,230,401 (GRCm39) K170* probably null Het
Phf24 T A 4: 42,937,906 (GRCm39) C173* probably null Het
Prss33 C A 17: 24,052,930 (GRCm39) W248L probably damaging Het
Rgs3 T G 4: 62,544,254 (GRCm39) L350R possibly damaging Het
Samd11 C T 4: 156,333,730 (GRCm39) G200D probably damaging Het
Sh3tc2 T A 18: 62,123,873 (GRCm39) V878E probably damaging Het
Sh3tc2 G C 18: 62,148,142 (GRCm39) G1284A probably benign Het
Skint5 A G 4: 113,572,900 (GRCm39) S780P unknown Het
Slc8a3 T C 12: 81,361,452 (GRCm39) K456E probably damaging Het
Smok2a T A 17: 13,444,499 (GRCm39) H25Q probably benign Het
Srrt A G 5: 137,298,589 (GRCm39) L225P possibly damaging Het
Stox1 C T 10: 62,500,754 (GRCm39) R602Q probably damaging Het
Tmem30a A T 9: 79,683,507 (GRCm39) C157S probably damaging Het
Tnks1bp1 T C 2: 84,892,622 (GRCm39) S850P probably damaging Het
Trpm6 A G 19: 18,809,849 (GRCm39) I1082V probably benign Het
Ttll5 T A 12: 85,965,895 (GRCm39) N646K probably benign Het
Vmn1r179 A T 7: 23,628,277 (GRCm39) Y156F probably benign Het
Vmn1r54 T A 6: 90,246,413 (GRCm39) L109H probably damaging Het
Wdr17 T C 8: 55,115,953 (GRCm39) I617V probably benign Het
Zeb2 T A 2: 44,886,183 (GRCm39) Q958L probably damaging Het
Other mutations in Plcb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Plcb2 APN 2 118,549,370 (GRCm39) missense probably damaging 1.00
IGL00715:Plcb2 APN 2 118,544,215 (GRCm39) critical splice donor site probably null
IGL00851:Plcb2 APN 2 118,558,732 (GRCm39) missense probably benign 0.30
IGL01765:Plcb2 APN 2 118,540,749 (GRCm39) splice site probably benign
IGL01837:Plcb2 APN 2 118,542,407 (GRCm39) splice site probably null
IGL01868:Plcb2 APN 2 118,541,868 (GRCm39) missense probably benign 0.09
IGL01868:Plcb2 APN 2 118,540,071 (GRCm39) missense probably damaging 1.00
IGL02158:Plcb2 APN 2 118,541,844 (GRCm39) missense probably benign 0.06
IGL02447:Plcb2 APN 2 118,543,636 (GRCm39) missense probably damaging 1.00
IGL02490:Plcb2 APN 2 118,550,241 (GRCm39) missense probably damaging 0.99
IGL02691:Plcb2 APN 2 118,541,444 (GRCm39) missense probably benign 0.00
IGL02723:Plcb2 APN 2 118,547,500 (GRCm39) splice site probably benign
IGL02929:Plcb2 APN 2 118,543,715 (GRCm39) splice site probably benign
IGL02949:Plcb2 APN 2 118,549,590 (GRCm39) splice site probably null
PIT4480001:Plcb2 UTSW 2 118,553,977 (GRCm39) missense probably benign 0.00
R0031:Plcb2 UTSW 2 118,545,942 (GRCm39) missense probably benign 0.36
R0157:Plcb2 UTSW 2 118,549,022 (GRCm39) missense probably damaging 0.98
R0366:Plcb2 UTSW 2 118,554,928 (GRCm39) missense probably benign 0.01
R0376:Plcb2 UTSW 2 118,547,721 (GRCm39) missense probably damaging 0.99
R0570:Plcb2 UTSW 2 118,547,806 (GRCm39) missense probably benign 0.32
R0790:Plcb2 UTSW 2 118,542,964 (GRCm39) splice site probably benign
R0893:Plcb2 UTSW 2 118,555,586 (GRCm39) splice site probably benign
R1647:Plcb2 UTSW 2 118,554,261 (GRCm39) missense possibly damaging 0.51
R1648:Plcb2 UTSW 2 118,554,261 (GRCm39) missense possibly damaging 0.51
R1686:Plcb2 UTSW 2 118,546,168 (GRCm39) splice site probably benign
R2210:Plcb2 UTSW 2 118,547,984 (GRCm39) missense probably damaging 1.00
R2211:Plcb2 UTSW 2 118,554,015 (GRCm39) missense probably benign 0.05
R2251:Plcb2 UTSW 2 118,554,246 (GRCm39) missense probably benign 0.10
R2252:Plcb2 UTSW 2 118,554,246 (GRCm39) missense probably benign 0.10
R2253:Plcb2 UTSW 2 118,554,246 (GRCm39) missense probably benign 0.10
R2426:Plcb2 UTSW 2 118,546,130 (GRCm39) missense probably damaging 1.00
R3970:Plcb2 UTSW 2 118,546,171 (GRCm39) splice site probably benign
R4007:Plcb2 UTSW 2 118,541,274 (GRCm39) missense probably damaging 1.00
R4162:Plcb2 UTSW 2 118,540,068 (GRCm39) missense probably damaging 1.00
R4236:Plcb2 UTSW 2 118,540,047 (GRCm39) missense probably damaging 1.00
R4422:Plcb2 UTSW 2 118,542,484 (GRCm39) missense probably benign 0.28
R4772:Plcb2 UTSW 2 118,543,615 (GRCm39) missense probably benign 0.20
R4795:Plcb2 UTSW 2 118,541,605 (GRCm39) missense probably benign 0.32
R4935:Plcb2 UTSW 2 118,549,396 (GRCm39) missense probably damaging 1.00
R5019:Plcb2 UTSW 2 118,542,617 (GRCm39) missense probably benign 0.01
R5055:Plcb2 UTSW 2 118,548,703 (GRCm39) missense probably benign 0.06
R5452:Plcb2 UTSW 2 118,548,727 (GRCm39) missense probably damaging 0.98
R5622:Plcb2 UTSW 2 118,545,210 (GRCm39) missense probably damaging 1.00
R5752:Plcb2 UTSW 2 118,541,532 (GRCm39) intron probably benign
R6284:Plcb2 UTSW 2 118,547,782 (GRCm39) missense probably benign 0.37
R6380:Plcb2 UTSW 2 118,545,949 (GRCm39) missense probably damaging 1.00
R6574:Plcb2 UTSW 2 118,549,654 (GRCm39) missense probably damaging 0.99
R6728:Plcb2 UTSW 2 118,554,171 (GRCm39) missense probably damaging 1.00
R6792:Plcb2 UTSW 2 118,549,922 (GRCm39) missense probably damaging 1.00
R7529:Plcb2 UTSW 2 118,540,715 (GRCm39) missense probably damaging 1.00
R7560:Plcb2 UTSW 2 118,546,124 (GRCm39) missense probably damaging 0.99
R7610:Plcb2 UTSW 2 118,550,240 (GRCm39) missense possibly damaging 0.86
R7760:Plcb2 UTSW 2 118,541,869 (GRCm39) missense probably benign
R8152:Plcb2 UTSW 2 118,541,302 (GRCm39) missense probably benign 0.22
R8170:Plcb2 UTSW 2 118,541,934 (GRCm39) missense possibly damaging 0.68
R8913:Plcb2 UTSW 2 118,544,365 (GRCm39) missense probably damaging 1.00
R9072:Plcb2 UTSW 2 118,547,878 (GRCm39) missense possibly damaging 0.67
R9758:Plcb2 UTSW 2 118,545,921 (GRCm39) missense probably damaging 0.97
R9773:Plcb2 UTSW 2 118,541,274 (GRCm39) missense probably damaging 1.00
X0024:Plcb2 UTSW 2 118,542,856 (GRCm39) missense probably benign 0.13
Z1176:Plcb2 UTSW 2 118,553,609 (GRCm39) missense probably damaging 0.99
Z1177:Plcb2 UTSW 2 118,539,681 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGAAGAGGGTAGCTTCTCC -3'
(R):5'- TCTGACAGGGCAGACTATGAG -3'

Sequencing Primer
(F):5'- AGAGGGTAGCTTCTCCCCACTAC -3'
(R):5'- CTATGAGGTAGCGAGGGGCC -3'
Posted On 2020-10-20