Mutagenetix > Incidental Mutation

Incidental Mutation 'R8413:Plcb2'

652773

Institutional Source

Beutler Lab

Gene Symbol

Plcb2

Ensembl Gene

ENSMUSG00000040061

Gene Name

phospholipase C, beta 2

Synonyms

B230205M18Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8413 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

118707517-118728438 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 118718823 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 353 (F353L)

Ref Sequence

ENSEMBL: ENSMUSP00000124364 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102524] [ENSMUST00000159756]

AlphaFold

A3KGF7

Predicted Effect

probably damaging
Transcript: ENSMUST00000102524
AA Change: F376L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000099583
Gene: ENSMUSG00000040061
AA Change: F376L

Domain	Start	End	E-Value	Type
low complexity region	3	13	N/A	INTRINSIC
Pfam:EF-hand_like	220	311	2.5e-24	PFAM
PLCXc	312	463	2.87e-79	SMART
low complexity region	504	518	N/A	INTRINSIC
PLCYc	547	663	2.39e-67	SMART
C2	684	783	9.17e-15	SMART
low complexity region	902	925	N/A	INTRINSIC
low complexity region	929	940	N/A	INTRINSIC
Pfam:PLC-beta_C	974	1149	4.7e-72	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000159756
AA Change: F353L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000124364
Gene: ENSMUSG00000040061
AA Change: F353L

Domain	Start	End	E-Value	Type
low complexity region	3	13	N/A	INTRINSIC
Pfam:EF-hand_like	197	288	7.1e-26	PFAM
PLCXc	289	440	2.87e-79	SMART
low complexity region	481	495	N/A	INTRINSIC
PLCYc	524	640	2.39e-67	SMART
C2	661	760	9.17e-15	SMART
low complexity region	879	902	N/A	INTRINSIC
low complexity region	906	917	N/A	INTRINSIC
Pfam:PLC-beta_C	946	1129	5.1e-68	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a phosphodiesterase that catalyzes the hydrolysis of phosphatidylinositol 4,5-bisphosphate to the second messengers inositol 1,4,5-trisphosphate (IP3) and diacylglycerol. The encoded protein is activated by G proteins and has been shown to be involved in the type 2 taste receptor signal transduction pathway. In addition, nuclear factor kappa B can regulate the transcription of this gene, whose protein product is also an important regulator of platelet responses. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygous mutant mice showed an increased sensitivity to both bacterial and viral infections and exhibited abnormal taste perception in which sweet, umami, and bitter stimuli could not be sensed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	T	A	7: 120,423,900	D86E	probably benign	Het
Adamts5	A	G	16: 85,866,618		probably null	Het
Arhgap31	T	C	16: 38,602,921	R928G	possibly damaging	Het
Birc6	T	C	17: 74,546,393	V164A	possibly damaging	Het
Cdh26	T	A	2: 178,468,229	H438Q	probably damaging	Het
Cfap65	T	A	1: 74,917,169	K1084*	probably null	Het
Csmd1	T	C	8: 15,900,676	H3511R	probably damaging	Het
Ebf1	T	A	11: 44,643,447	S178T	possibly damaging	Het
Eln	A	G	5: 134,726,521	V226A	unknown	Het
Fat4	A	T	3: 39,008,979		probably null	Het
Gcn1l1	C	T	5: 115,579,639	T222I	probably benign	Het
Gm11639	A	C	11: 104,920,309	K3192N	unknown	Het
Gm5624	T	G	14: 44,561,890	N70T		Het
Gpc6	T	A	14: 117,892,349	V387E	possibly damaging	Het
Gyg	C	T	3: 20,125,455	V255M	probably damaging	Het
Henmt1	T	A	3: 108,957,649	F146I	probably damaging	Het
Itpr3	T	A	17: 27,111,926	L1736Q	probably damaging	Het
Kcnh4	A	G	11: 100,749,793	V469A	possibly damaging	Het
Mybpc2	A	G	7: 44,508,305	L750P	probably damaging	Het
Naalad2	A	G	9: 18,330,643	V655A	probably damaging	Het
Nme8	C	T	13: 19,674,519	D289N	probably benign	Het
Olfr1109	T	C	2: 87,093,158	K80E	probably benign	Het
Olfr1199	T	A	2: 88,756,680		probably benign	Het
Olfr358	T	G	2: 37,005,390	T75P	probably damaging	Het
Olfr720	A	G	14: 14,175,416	V222A	probably benign	Het
Olfr727	C	G	14: 50,127,370	S264R	probably benign	Het
Olfr948	T	A	9: 39,319,105	K170*	probably null	Het
Phf24	T	A	4: 42,937,906	C173*	probably null	Het
Prss33	C	A	17: 23,833,956	W248L	probably damaging	Het
Rgs3	T	G	4: 62,626,017	L350R	possibly damaging	Het
Samd11	C	T	4: 156,249,273	G200D	probably damaging	Het
Sh3tc2	T	A	18: 61,990,802	V878E	probably damaging	Het
Sh3tc2	G	C	18: 62,015,071	G1284A	probably benign	Het
Skint5	A	G	4: 113,715,703	S780P	unknown	Het
Slc8a3	T	C	12: 81,314,678	K456E	probably damaging	Het
Smok2a	T	A	17: 13,225,612	H25Q	probably benign	Het
Srrt	A	G	5: 137,300,327	L225P	possibly damaging	Het
Stox1	C	T	10: 62,664,975	R602Q	probably damaging	Het
Tmem30a	A	T	9: 79,776,225	C157S	probably damaging	Het
Tnks1bp1	T	C	2: 85,062,278	S850P	probably damaging	Het
Trpm6	A	G	19: 18,832,485	I1082V	probably benign	Het
Ttll5	T	A	12: 85,919,121	N646K	probably benign	Het
Vmn1r179	A	T	7: 23,928,852	Y156F	probably benign	Het
Vmn1r54	T	A	6: 90,269,431	L109H	probably damaging	Het
Wdr17	T	C	8: 54,662,918	I617V	probably benign	Het
Zeb2	T	A	2: 44,996,171	Q958L	probably damaging	Het

Other mutations in Plcb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00580:Plcb2	APN	2	118718889	missense	probably damaging	1.00
IGL00715:Plcb2	APN	2	118713734	critical splice donor site	probably null
IGL00851:Plcb2	APN	2	118728251	missense	probably benign	0.30
IGL01765:Plcb2	APN	2	118710268	splice site	probably benign
IGL01837:Plcb2	APN	2	118711926	splice site	probably null
IGL01868:Plcb2	APN	2	118709590	missense	probably damaging	1.00
IGL01868:Plcb2	APN	2	118711387	missense	probably benign	0.09
IGL02158:Plcb2	APN	2	118711363	missense	probably benign	0.06
IGL02447:Plcb2	APN	2	118713155	missense	probably damaging	1.00
IGL02490:Plcb2	APN	2	118719760	missense	probably damaging	0.99
IGL02691:Plcb2	APN	2	118710963	missense	probably benign	0.00
IGL02723:Plcb2	APN	2	118717019	splice site	probably benign
IGL02929:Plcb2	APN	2	118713234	splice site	probably benign
IGL02949:Plcb2	APN	2	118719109	splice site	probably null
PIT4480001:Plcb2	UTSW	2	118723496	missense	probably benign	0.00
R0031:Plcb2	UTSW	2	118715461	missense	probably benign	0.36
R0157:Plcb2	UTSW	2	118718541	missense	probably damaging	0.98
R0366:Plcb2	UTSW	2	118724447	missense	probably benign	0.01
R0376:Plcb2	UTSW	2	118717240	missense	probably damaging	0.99
R0570:Plcb2	UTSW	2	118717325	missense	probably benign	0.32
R0790:Plcb2	UTSW	2	118712483	splice site	probably benign
R0893:Plcb2	UTSW	2	118725105	splice site	probably benign
R1647:Plcb2	UTSW	2	118723780	missense	possibly damaging	0.51
R1648:Plcb2	UTSW	2	118723780	missense	possibly damaging	0.51
R1686:Plcb2	UTSW	2	118715687	splice site	probably benign
R2210:Plcb2	UTSW	2	118717503	missense	probably damaging	1.00
R2211:Plcb2	UTSW	2	118723534	missense	probably benign	0.05
R2251:Plcb2	UTSW	2	118723765	missense	probably benign	0.10
R2252:Plcb2	UTSW	2	118723765	missense	probably benign	0.10
R2253:Plcb2	UTSW	2	118723765	missense	probably benign	0.10
R2426:Plcb2	UTSW	2	118715649	missense	probably damaging	1.00
R3970:Plcb2	UTSW	2	118715690	splice site	probably benign
R4007:Plcb2	UTSW	2	118710793	missense	probably damaging	1.00
R4162:Plcb2	UTSW	2	118709587	missense	probably damaging	1.00
R4236:Plcb2	UTSW	2	118709566	missense	probably damaging	1.00
R4422:Plcb2	UTSW	2	118712003	missense	probably benign	0.28
R4772:Plcb2	UTSW	2	118713134	missense	probably benign	0.20
R4795:Plcb2	UTSW	2	118711124	missense	probably benign	0.32
R4935:Plcb2	UTSW	2	118718915	missense	probably damaging	1.00
R5019:Plcb2	UTSW	2	118712136	missense	probably benign	0.01
R5055:Plcb2	UTSW	2	118718222	missense	probably benign	0.06
R5452:Plcb2	UTSW	2	118718246	missense	probably damaging	0.98
R5622:Plcb2	UTSW	2	118714729	missense	probably damaging	1.00
R5752:Plcb2	UTSW	2	118711051	intron	probably benign
R6284:Plcb2	UTSW	2	118717301	missense	probably benign	0.37
R6380:Plcb2	UTSW	2	118715468	missense	probably damaging	1.00
R6574:Plcb2	UTSW	2	118719173	missense	probably damaging	0.99
R6728:Plcb2	UTSW	2	118723690	missense	probably damaging	1.00
R6792:Plcb2	UTSW	2	118719441	missense	probably damaging	1.00
R7529:Plcb2	UTSW	2	118710234	missense	probably damaging	1.00
R7560:Plcb2	UTSW	2	118715643	missense	probably damaging	0.99
R7610:Plcb2	UTSW	2	118719759	missense	possibly damaging	0.86
R7760:Plcb2	UTSW	2	118711388	missense	probably benign
R8152:Plcb2	UTSW	2	118710821	missense	probably benign	0.22
R8170:Plcb2	UTSW	2	118711453	missense	possibly damaging	0.68
R8913:Plcb2	UTSW	2	118713884	missense	probably damaging	1.00
R9072:Plcb2	UTSW	2	118717397	missense	possibly damaging	0.67
R9758:Plcb2	UTSW	2	118715440	missense	probably damaging	0.97
R9773:Plcb2	UTSW	2	118710793	missense	probably damaging	1.00
X0024:Plcb2	UTSW	2	118712375	missense	probably benign	0.13
Z1176:Plcb2	UTSW	2	118723128	missense	probably damaging	0.99
Z1177:Plcb2	UTSW	2	118709200	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GTGAAGAGGGTAGCTTCTCC -3'
(R):5'- TCTGACAGGGCAGACTATGAG -3'

Sequencing Primer
(F):5'- AGAGGGTAGCTTCTCCCCACTAC -3'
(R):5'- CTATGAGGTAGCGAGGGGCC -3'

Posted On

2020-10-20