Incidental Mutation 'R8413:Skint5'
ID652780
Institutional Source Beutler Lab
Gene Symbol Skint5
Ensembl Gene ENSMUSG00000078598
Gene Nameselection and upkeep of intraepithelial T cells 5
SynonymsOTTMUSG00000008560
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R8413 (G1)
Quality Score185.009
Status Not validated
Chromosome4
Chromosomal Location113477891-113999503 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113715703 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 780 (S780P)
Ref Sequence ENSEMBL: ENSMUSP00000132470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169631] [ENSMUST00000170105]
Predicted Effect unknown
Transcript: ENSMUST00000169631
AA Change: S780P
SMART Domains Protein: ENSMUSP00000132470
Gene: ENSMUSG00000078598
AA Change: S780P

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
IGv 58 139 2.48e-8 SMART
Blast:IG_like 173 249 2e-16 BLAST
internal_repeat_2 282 614 9.14e-29 PROSPERO
internal_repeat_1 284 770 2.19e-39 PROSPERO
low complexity region 772 781 N/A INTRINSIC
internal_repeat_1 808 1294 2.19e-39 PROSPERO
internal_repeat_2 995 1306 9.14e-29 PROSPERO
transmembrane domain 1322 1341 N/A INTRINSIC
transmembrane domain 1361 1383 N/A INTRINSIC
transmembrane domain 1398 1420 N/A INTRINSIC
transmembrane domain 1441 1463 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000170105
AA Change: S780P
SMART Domains Protein: ENSMUSP00000129582
Gene: ENSMUSG00000078598
AA Change: S780P

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
IGv 58 139 2.48e-8 SMART
Pfam:C2-set_2 162 238 3.9e-6 PFAM
internal_repeat_3 276 364 2.13e-10 PROSPERO
internal_repeat_2 282 593 3.81e-24 PROSPERO
internal_repeat_1 284 749 6.25e-39 PROSPERO
low complexity region 751 760 N/A INTRINSIC
low complexity region 772 781 N/A INTRINSIC
internal_repeat_1 808 1273 6.25e-39 PROSPERO
internal_repeat_2 995 1285 3.81e-24 PROSPERO
internal_repeat_3 1196 1287 2.13e-10 PROSPERO
transmembrane domain 1301 1320 N/A INTRINSIC
transmembrane domain 1340 1362 N/A INTRINSIC
transmembrane domain 1377 1399 N/A INTRINSIC
transmembrane domain 1420 1442 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T A 7: 120,423,900 D86E probably benign Het
Adamts5 A G 16: 85,866,618 probably null Het
Arhgap31 T C 16: 38,602,921 R928G possibly damaging Het
Birc6 T C 17: 74,546,393 V164A possibly damaging Het
Cdh26 T A 2: 178,468,229 H438Q probably damaging Het
Cfap65 T A 1: 74,917,169 K1084* probably null Het
Csmd1 T C 8: 15,900,676 H3511R probably damaging Het
Ebf1 T A 11: 44,643,447 S178T possibly damaging Het
Eln A G 5: 134,726,521 V226A unknown Het
Fat4 A T 3: 39,008,979 probably null Het
Gcn1l1 C T 5: 115,579,639 T222I probably benign Het
Gm11639 A C 11: 104,920,309 K3192N unknown Het
Gm5624 T G 14: 44,561,890 N70T Het
Gpc6 T A 14: 117,892,349 V387E possibly damaging Het
Gyg C T 3: 20,125,455 V255M probably damaging Het
Henmt1 T A 3: 108,957,649 F146I probably damaging Het
Itpr3 T A 17: 27,111,926 L1736Q probably damaging Het
Kcnh4 A G 11: 100,749,793 V469A possibly damaging Het
Mybpc2 A G 7: 44,508,305 L750P probably damaging Het
Naalad2 A G 9: 18,330,643 V655A probably damaging Het
Nme8 C T 13: 19,674,519 D289N probably benign Het
Olfr1109 T C 2: 87,093,158 K80E probably benign Het
Olfr1199 T A 2: 88,756,680 probably benign Het
Olfr358 T G 2: 37,005,390 T75P probably damaging Het
Olfr720 A G 14: 14,175,416 V222A probably benign Het
Olfr727 C G 14: 50,127,370 S264R probably benign Het
Olfr948 T A 9: 39,319,105 K170* probably null Het
Phf24 T A 4: 42,937,906 C173* probably null Het
Plcb2 A G 2: 118,718,823 F353L probably damaging Het
Prss33 C A 17: 23,833,956 W248L probably damaging Het
Rgs3 T G 4: 62,626,017 L350R possibly damaging Het
Samd11 C T 4: 156,249,273 G200D probably damaging Het
Sh3tc2 T A 18: 61,990,802 V878E probably damaging Het
Sh3tc2 G C 18: 62,015,071 G1284A probably benign Het
Slc8a3 T C 12: 81,314,678 K456E probably damaging Het
Smok2a T A 17: 13,225,612 H25Q probably benign Het
Srrt A G 5: 137,300,327 L225P possibly damaging Het
Stox1 C T 10: 62,664,975 R602Q probably damaging Het
Tmem30a A T 9: 79,776,225 C157S probably damaging Het
Tnks1bp1 T C 2: 85,062,278 S850P probably damaging Het
Trpm6 A G 19: 18,832,485 I1082V probably benign Het
Ttll5 T A 12: 85,919,121 N646K probably benign Het
Vmn1r179 A T 7: 23,928,852 Y156F probably benign Het
Vmn1r54 T A 6: 90,269,431 L109H probably damaging Het
Wdr17 T C 8: 54,662,918 I617V probably benign Het
Zeb2 T A 2: 44,996,171 Q958L probably damaging Het
Other mutations in Skint5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Skint5 APN 4 113542873 critical splice donor site probably null
IGL01288:Skint5 APN 4 113524135 intron probably benign
IGL01313:Skint5 APN 4 113805164 missense unknown
IGL01446:Skint5 APN 4 113942822 missense probably damaging 1.00
IGL01861:Skint5 APN 4 113559824 splice site probably benign
IGL01955:Skint5 APN 4 113623736 critical splice donor site probably null
IGL02150:Skint5 APN 4 113885791 missense unknown
IGL02190:Skint5 APN 4 113940765 missense possibly damaging 0.93
IGL02271:Skint5 APN 4 113937581 splice site probably null
IGL02426:Skint5 APN 4 113940784 missense probably benign 0.08
IGL02484:Skint5 APN 4 113942553 nonsense probably null
IGL02548:Skint5 APN 4 113731076 missense unknown
IGL02556:Skint5 APN 4 113940735 missense probably damaging 0.99
IGL02674:Skint5 APN 4 113630385 splice site probably benign
IGL02697:Skint5 APN 4 113479713 missense probably benign 0.23
IGL02710:Skint5 APN 4 113477959 missense unknown
IGL02721:Skint5 APN 4 113942549 missense probably damaging 0.96
IGL02750:Skint5 APN 4 113539362 missense unknown
IGL03121:Skint5 APN 4 113717087 missense unknown
IGL03167:Skint5 APN 4 113893850 missense unknown
IGL03247:Skint5 APN 4 113940808 missense probably damaging 1.00
IGL03264:Skint5 APN 4 113486657 missense unknown
IGL03281:Skint5 APN 4 113667218 missense unknown
IGL03353:Skint5 APN 4 113742182 missense unknown
IGL03377:Skint5 APN 4 113763538 missense unknown
PIT4377001:Skint5 UTSW 4 113597703 missense unknown
R0006:Skint5 UTSW 4 113893862 splice site probably benign
R0026:Skint5 UTSW 4 113546468 splice site probably benign
R0096:Skint5 UTSW 4 113597768 splice site probably benign
R0096:Skint5 UTSW 4 113597768 splice site probably benign
R0277:Skint5 UTSW 4 113937621 missense probably benign 0.04
R0323:Skint5 UTSW 4 113937621 missense probably benign 0.04
R0369:Skint5 UTSW 4 113512023 critical splice donor site probably null
R0375:Skint5 UTSW 4 113705596 missense unknown
R0464:Skint5 UTSW 4 113535731 missense unknown
R0479:Skint5 UTSW 4 113655672 missense unknown
R0507:Skint5 UTSW 4 113567930 splice site probably null
R0533:Skint5 UTSW 4 113827867 missense unknown
R0628:Skint5 UTSW 4 113731069 nonsense probably null
R0645:Skint5 UTSW 4 113763482 missense unknown
R1201:Skint5 UTSW 4 113556145 missense unknown
R1240:Skint5 UTSW 4 113717107 missense unknown
R1270:Skint5 UTSW 4 113942659 nonsense probably null
R1390:Skint5 UTSW 4 113655684 missense unknown
R1398:Skint5 UTSW 4 113779071 missense unknown
R1438:Skint5 UTSW 4 113556111 splice site probably benign
R1591:Skint5 UTSW 4 113999454 critical splice donor site probably null
R1631:Skint5 UTSW 4 113483926 missense probably benign 0.23
R1653:Skint5 UTSW 4 113490678 missense unknown
R1722:Skint5 UTSW 4 113846311 splice site probably null
R1735:Skint5 UTSW 4 113563459 missense unknown
R1765:Skint5 UTSW 4 113577661 missense unknown
R2054:Skint5 UTSW 4 113819163 critical splice donor site probably null
R2058:Skint5 UTSW 4 113870700 missense possibly damaging 0.53
R2197:Skint5 UTSW 4 113940849 missense probably damaging 1.00
R2239:Skint5 UTSW 4 113546536 missense unknown
R2380:Skint5 UTSW 4 113546536 missense unknown
R2406:Skint5 UTSW 4 113942667 missense probably damaging 0.97
R2512:Skint5 UTSW 4 113630419 missense unknown
R2913:Skint5 UTSW 4 113524092 intron probably benign
R3522:Skint5 UTSW 4 113756905 critical splice donor site probably null
R3779:Skint5 UTSW 4 113779040 splice site probably benign
R3815:Skint5 UTSW 4 113629122 splice site probably benign
R3815:Skint5 UTSW 4 113846299 missense possibly damaging 0.86
R3816:Skint5 UTSW 4 113629122 splice site probably benign
R3817:Skint5 UTSW 4 113629122 splice site probably benign
R3818:Skint5 UTSW 4 113629122 splice site probably benign
R3837:Skint5 UTSW 4 113940741 missense probably damaging 1.00
R3943:Skint5 UTSW 4 113942753 missense probably damaging 1.00
R3944:Skint5 UTSW 4 113942753 missense probably damaging 1.00
R4037:Skint5 UTSW 4 113885814 missense unknown
R4038:Skint5 UTSW 4 113885814 missense unknown
R4039:Skint5 UTSW 4 113885814 missense unknown
R4280:Skint5 UTSW 4 113942552 missense probably damaging 1.00
R4308:Skint5 UTSW 4 113483967 missense unknown
R4386:Skint5 UTSW 4 113483893 missense probably benign 0.23
R4513:Skint5 UTSW 4 113742185 missense unknown
R4575:Skint5 UTSW 4 113667193 missense unknown
R4631:Skint5 UTSW 4 113629117 critical splice acceptor site probably null
R4722:Skint5 UTSW 4 113893855 missense unknown
R4854:Skint5 UTSW 4 113580528 missense unknown
R5010:Skint5 UTSW 4 113546537 missense unknown
R5070:Skint5 UTSW 4 113795538 missense unknown
R5158:Skint5 UTSW 4 113742212 missense unknown
R5163:Skint5 UTSW 4 113795565 missense unknown
R5190:Skint5 UTSW 4 113763514 missense unknown
R5232:Skint5 UTSW 4 113577644 missense unknown
R5257:Skint5 UTSW 4 113577662 missense unknown
R5499:Skint5 UTSW 4 113942503 critical splice donor site probably null
R5569:Skint5 UTSW 4 113688706 critical splice acceptor site probably null
R5776:Skint5 UTSW 4 113763503 missense unknown
R5986:Skint5 UTSW 4 113995648 missense probably benign 0.11
R5987:Skint5 UTSW 4 113885808 missense unknown
R5995:Skint5 UTSW 4 113893832 missense unknown
R6063:Skint5 UTSW 4 113490645 missense probably benign 0.23
R6074:Skint5 UTSW 4 113805200 missense unknown
R6111:Skint5 UTSW 4 113705648 missense unknown
R6173:Skint5 UTSW 4 113535710 missense unknown
R6238:Skint5 UTSW 4 113942867 splice site probably null
R6248:Skint5 UTSW 4 113779089 missense unknown
R6318:Skint5 UTSW 4 113517133 missense unknown
R6370:Skint5 UTSW 4 113614110 missense unknown
R6404:Skint5 UTSW 4 113942609 missense probably damaging 0.97
R6499:Skint5 UTSW 4 113539355 missense unknown
R6646:Skint5 UTSW 4 113940777 missense possibly damaging 0.94
R6737:Skint5 UTSW 4 113535739 missense unknown
R6795:Skint5 UTSW 4 113667223 missense unknown
R6815:Skint5 UTSW 4 113717127 critical splice acceptor site probably null
R6935:Skint5 UTSW 4 113942596 missense possibly damaging 0.56
R7028:Skint5 UTSW 4 113940839 missense probably damaging 1.00
R7043:Skint5 UTSW 4 113717107 missense unknown
R7071:Skint5 UTSW 4 113779080 missense unknown
R7142:Skint5 UTSW 4 113571594 missense unknown
R7197:Skint5 UTSW 4 113580482 critical splice donor site probably null
R7208:Skint5 UTSW 4 113539339 missense unknown
R7297:Skint5 UTSW 4 113542934 missense unknown
R7470:Skint5 UTSW 4 113756931 missense unknown
R7470:Skint5 UTSW 4 113885803 missense unknown
R7500:Skint5 UTSW 4 113559838 missense unknown
R7547:Skint5 UTSW 4 113626588 missense unknown
R7556:Skint5 UTSW 4 113567965 missense unknown
R7619:Skint5 UTSW 4 113524108 missense unknown
R7629:Skint5 UTSW 4 113942660 missense probably damaging 1.00
R7646:Skint5 UTSW 4 113763542 critical splice acceptor site probably null
R7725:Skint5 UTSW 4 113827902 missense unknown
R7788:Skint5 UTSW 4 113546518 missense unknown
R7818:Skint5 UTSW 4 113942726 missense possibly damaging 0.56
R7819:Skint5 UTSW 4 113559835 missense unknown
R7958:Skint5 UTSW 4 113623783 missense unknown
R8150:Skint5 UTSW 4 113940890 missense probably benign 0.21
R8214:Skint5 UTSW 4 113804942 splice site probably null
R8420:Skint5 UTSW 4 113580482 critical splice donor site probably null
R8459:Skint5 UTSW 4 113846284 nonsense probably null
R8703:Skint5 UTSW 4 113876010 missense unknown
R8710:Skint5 UTSW 4 113626590 missense unknown
R8928:Skint5 UTSW 4 113483902 missense probably benign 0.23
R8950:Skint5 UTSW 4 113517152 missense unknown
X0028:Skint5 UTSW 4 113691109 missense unknown
Predicted Primers PCR Primer
(F):5'- TGGCCTATGATTGAGAAGAGCTG -3'
(R):5'- GCTCTCTATGACAAGAGTGTATCCAC -3'

Sequencing Primer
(F):5'- TTGAGAAGAGCTGAATATTGACAC -3'
(R):5'- GGATGCAGTATGGTCATCA -3'
Posted On2020-10-20