Incidental Mutation 'R8413:Abca16'
ID652788
Institutional Source Beutler Lab
Gene Symbol Abca16
Ensembl Gene ENSMUSG00000051900
Gene NameATP-binding cassette, sub-family A (ABC1), member 16
Synonyms
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_001278943.1, NM_001278944.1; MGI:2388711

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8413 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location120409647-120544813 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 120423900 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 86 (D86E)
Ref Sequence ENSEMBL: ENSMUSP00000112736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056042] [ENSMUST00000120490]
Predicted Effect probably benign
Transcript: ENSMUST00000056042
AA Change: D86E

PolyPhen 2 Score 0.243 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000061094
Gene: ENSMUSG00000051900
AA Change: D86E

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 26 455 2.7e-23 PFAM
AAA 537 720 2.01e-7 SMART
Pfam:ABC2_membrane_3 898 1287 4.6e-25 PFAM
low complexity region 1325 1336 N/A INTRINSIC
low complexity region 1342 1353 N/A INTRINSIC
AAA 1378 1563 4.23e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120490
AA Change: D86E

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000112736
Gene: ENSMUSG00000051900
AA Change: D86E

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 25 456 2.4e-22 PFAM
AAA 538 721 2.01e-7 SMART
Pfam:ABC2_membrane_3 899 1288 1.1e-27 PFAM
low complexity region 1326 1337 N/A INTRINSIC
low complexity region 1343 1354 N/A INTRINSIC
AAA 1379 1564 4.23e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts5 A G 16: 85,866,618 probably null Het
Arhgap31 T C 16: 38,602,921 R928G possibly damaging Het
Birc6 T C 17: 74,546,393 V164A possibly damaging Het
Cdh26 T A 2: 178,468,229 H438Q probably damaging Het
Cfap65 T A 1: 74,917,169 K1084* probably null Het
Csmd1 T C 8: 15,900,676 H3511R probably damaging Het
Ebf1 T A 11: 44,643,447 S178T possibly damaging Het
Eln A G 5: 134,726,521 V226A unknown Het
Fat4 A T 3: 39,008,979 probably null Het
Gcn1l1 C T 5: 115,579,639 T222I probably benign Het
Gm11639 A C 11: 104,920,309 K3192N unknown Het
Gm5624 T G 14: 44,561,890 N70T Het
Gpc6 T A 14: 117,892,349 V387E possibly damaging Het
Gyg C T 3: 20,125,455 V255M probably damaging Het
Henmt1 T A 3: 108,957,649 F146I probably damaging Het
Itpr3 T A 17: 27,111,926 L1736Q probably damaging Het
Kcnh4 A G 11: 100,749,793 V469A possibly damaging Het
Mybpc2 A G 7: 44,508,305 L750P probably damaging Het
Naalad2 A G 9: 18,330,643 V655A probably damaging Het
Nme8 C T 13: 19,674,519 D289N probably benign Het
Olfr1109 T C 2: 87,093,158 K80E probably benign Het
Olfr1199 T A 2: 88,756,680 probably benign Het
Olfr358 T G 2: 37,005,390 T75P probably damaging Het
Olfr720 A G 14: 14,175,416 V222A probably benign Het
Olfr727 C G 14: 50,127,370 S264R probably benign Het
Olfr948 T A 9: 39,319,105 K170* probably null Het
Phf24 T A 4: 42,937,906 C173* probably null Het
Plcb2 A G 2: 118,718,823 F353L probably damaging Het
Prss33 C A 17: 23,833,956 W248L probably damaging Het
Rgs3 T G 4: 62,626,017 L350R possibly damaging Het
Samd11 C T 4: 156,249,273 G200D probably damaging Het
Sh3tc2 T A 18: 61,990,802 V878E probably damaging Het
Sh3tc2 G C 18: 62,015,071 G1284A probably benign Het
Skint5 A G 4: 113,715,703 S780P unknown Het
Slc8a3 T C 12: 81,314,678 K456E probably damaging Het
Smok2a T A 17: 13,225,612 H25Q probably benign Het
Srrt A G 5: 137,300,327 L225P possibly damaging Het
Stox1 C T 10: 62,664,975 R602Q probably damaging Het
Tmem30a A T 9: 79,776,225 C157S probably damaging Het
Tnks1bp1 T C 2: 85,062,278 S850P probably damaging Het
Trpm6 A G 19: 18,832,485 I1082V probably benign Het
Ttll5 T A 12: 85,919,121 N646K probably benign Het
Vmn1r179 A T 7: 23,928,852 Y156F probably benign Het
Vmn1r54 T A 6: 90,269,431 L109H probably damaging Het
Wdr17 T C 8: 54,662,918 I617V probably benign Het
Zeb2 T A 2: 44,996,171 Q958L probably damaging Het
Other mutations in Abca16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Abca16 APN 7 120423759 missense probably benign 0.08
IGL00590:Abca16 APN 7 120423815 missense probably damaging 1.00
IGL01320:Abca16 APN 7 120439199 missense probably damaging 1.00
IGL01322:Abca16 APN 7 120439199 missense probably damaging 1.00
IGL01613:Abca16 APN 7 120541277 missense probably benign 0.03
IGL01774:Abca16 APN 7 120477835 missense probably damaging 1.00
IGL01774:Abca16 APN 7 120421801 splice site probably benign
IGL01797:Abca16 APN 7 120514537 missense probably benign 0.15
IGL02406:Abca16 APN 7 120540602 missense probably damaging 1.00
IGL02437:Abca16 APN 7 120533729 missense probably benign 0.00
IGL02541:Abca16 APN 7 120514658 missense possibly damaging 0.91
IGL02576:Abca16 APN 7 120433455 missense probably benign 0.05
IGL02578:Abca16 APN 7 120423956 critical splice donor site probably null
IGL03156:Abca16 APN 7 120423851 missense possibly damaging 0.69
IGL03381:Abca16 APN 7 120527818 missense probably benign 0.12
PIT4802001:Abca16 UTSW 7 120540128 missense probably benign 0.31
R0024:Abca16 UTSW 7 120433385 missense probably damaging 1.00
R0026:Abca16 UTSW 7 120477923 splice site probably benign
R0026:Abca16 UTSW 7 120477923 splice site probably benign
R0123:Abca16 UTSW 7 120540155 missense probably damaging 1.00
R0134:Abca16 UTSW 7 120540155 missense probably damaging 1.00
R0225:Abca16 UTSW 7 120540155 missense probably damaging 1.00
R0346:Abca16 UTSW 7 120435932 missense probably damaging 1.00
R0355:Abca16 UTSW 7 120423798 missense possibly damaging 0.68
R0358:Abca16 UTSW 7 120544716 missense probably benign 0.01
R0525:Abca16 UTSW 7 120465810 nonsense probably null
R0617:Abca16 UTSW 7 120433611 splice site probably benign
R0625:Abca16 UTSW 7 120435893 missense probably damaging 1.00
R0835:Abca16 UTSW 7 120465784 missense probably benign 0.42
R1445:Abca16 UTSW 7 120520033 missense probably benign 0.41
R1535:Abca16 UTSW 7 120540705 missense probably benign 0.30
R1567:Abca16 UTSW 7 120431129 missense probably benign 0.08
R1694:Abca16 UTSW 7 120520084 missense probably damaging 1.00
R1860:Abca16 UTSW 7 120534763 missense probably benign 0.02
R1876:Abca16 UTSW 7 120433385 missense probably damaging 1.00
R1913:Abca16 UTSW 7 120541240 missense probably benign 0.04
R1940:Abca16 UTSW 7 120433609 splice site probably benign
R2042:Abca16 UTSW 7 120544718 missense probably benign
R2115:Abca16 UTSW 7 120540645 missense probably damaging 1.00
R2122:Abca16 UTSW 7 120519961 missense probably damaging 1.00
R2265:Abca16 UTSW 7 120431160 missense probably benign 0.03
R2267:Abca16 UTSW 7 120431160 missense probably benign 0.03
R2269:Abca16 UTSW 7 120431160 missense probably benign 0.03
R2993:Abca16 UTSW 7 120535161 missense probably damaging 1.00
R3055:Abca16 UTSW 7 120435851 missense probably benign 0.05
R3956:Abca16 UTSW 7 120527752 missense probably damaging 0.96
R4114:Abca16 UTSW 7 120527067 missense probably benign 0.06
R4441:Abca16 UTSW 7 120527801 missense probably benign 0.04
R4601:Abca16 UTSW 7 120436697 missense probably damaging 0.98
R4706:Abca16 UTSW 7 120465765 missense probably damaging 1.00
R4807:Abca16 UTSW 7 120540609 missense probably damaging 1.00
R4824:Abca16 UTSW 7 120475479 missense possibly damaging 0.86
R4937:Abca16 UTSW 7 120527086 missense probably damaging 0.98
R5152:Abca16 UTSW 7 120540623 missense probably benign 0.02
R5257:Abca16 UTSW 7 120436769 critical splice donor site probably null
R5258:Abca16 UTSW 7 120436769 critical splice donor site probably null
R5330:Abca16 UTSW 7 120503377 missense probably benign 0.15
R5388:Abca16 UTSW 7 120540746 critical splice donor site probably null
R5590:Abca16 UTSW 7 120544772 missense probably damaging 0.98
R5810:Abca16 UTSW 7 120435932 missense probably damaging 1.00
R6030:Abca16 UTSW 7 120533798 missense probably benign
R6030:Abca16 UTSW 7 120533798 missense probably benign
R6161:Abca16 UTSW 7 120540711 missense probably damaging 1.00
R6313:Abca16 UTSW 7 120527121 missense probably damaging 1.00
R6485:Abca16 UTSW 7 120427167 nonsense probably null
R6527:Abca16 UTSW 7 120477772 missense possibly damaging 0.95
R6772:Abca16 UTSW 7 120527053 missense probably damaging 1.00
R6885:Abca16 UTSW 7 120520109 missense probably benign 0.07
R6899:Abca16 UTSW 7 120527041 missense probably damaging 1.00
R6941:Abca16 UTSW 7 120541147 missense probably damaging 1.00
R6990:Abca16 UTSW 7 120527727 missense probably benign 0.00
R7059:Abca16 UTSW 7 120421748 missense probably benign 0.00
R7144:Abca16 UTSW 7 120433573 missense possibly damaging 0.89
R7146:Abca16 UTSW 7 120527751 missense possibly damaging 0.46
R7193:Abca16 UTSW 7 120427186 missense probably damaging 1.00
R7308:Abca16 UTSW 7 120423770 missense probably benign 0.01
R7449:Abca16 UTSW 7 120435908 missense possibly damaging 0.95
R7571:Abca16 UTSW 7 120519988 missense probably benign 0.11
R7617:Abca16 UTSW 7 120503471 nonsense probably null
R7646:Abca16 UTSW 7 120514714 missense probably benign 0.04
R7750:Abca16 UTSW 7 120514705 missense probably benign 0.09
R7763:Abca16 UTSW 7 120514602 missense probably damaging 1.00
R7840:Abca16 UTSW 7 120475466 missense probably benign 0.00
R7946:Abca16 UTSW 7 120527175 missense probably benign 0.01
R8018:Abca16 UTSW 7 120533643 missense probably benign 0.04
R8170:Abca16 UTSW 7 120465782 missense probably damaging 1.00
R8461:Abca16 UTSW 7 120436695 missense possibly damaging 0.95
R8858:Abca16 UTSW 7 120453104 missense probably benign
R8881:Abca16 UTSW 7 120475571 missense probably benign 0.18
RF020:Abca16 UTSW 7 120533657 missense possibly damaging 0.90
X0066:Abca16 UTSW 7 120503386 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAGAACTCTTGGCAGCTTTG -3'
(R):5'- ATTCAGAGATGATGCACCCAAC -3'

Sequencing Primer
(F):5'- AGCTTTGCTGTTTGTAATAATGTTG -3'
(R):5'- GTCTACCTTTGATAGTGGTG -3'
Posted On2020-10-20