Incidental Mutation 'R8413:Abca16'
ID 652788
Institutional Source Beutler Lab
Gene Symbol Abca16
Ensembl Gene ENSMUSG00000051900
Gene Name ATP-binding cassette, sub-family A member 16
Synonyms
MMRRC Submission 067767-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8413 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 120008870-120144036 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 120023123 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 86 (D86E)
Ref Sequence ENSEMBL: ENSMUSP00000112736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056042] [ENSMUST00000120490]
AlphaFold E9PWJ7
Predicted Effect probably benign
Transcript: ENSMUST00000056042
AA Change: D86E

PolyPhen 2 Score 0.243 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000061094
Gene: ENSMUSG00000051900
AA Change: D86E

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 26 455 2.7e-23 PFAM
AAA 537 720 2.01e-7 SMART
Pfam:ABC2_membrane_3 898 1287 4.6e-25 PFAM
low complexity region 1325 1336 N/A INTRINSIC
low complexity region 1342 1353 N/A INTRINSIC
AAA 1378 1563 4.23e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120490
AA Change: D86E

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000112736
Gene: ENSMUSG00000051900
AA Change: D86E

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 25 456 2.4e-22 PFAM
AAA 538 721 2.01e-7 SMART
Pfam:ABC2_membrane_3 899 1288 1.1e-27 PFAM
low complexity region 1326 1337 N/A INTRINSIC
low complexity region 1343 1354 N/A INTRINSIC
AAA 1379 1564 4.23e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts5 A G 16: 85,663,506 (GRCm39) probably null Het
Arhgap31 T C 16: 38,423,283 (GRCm39) R928G possibly damaging Het
Birc6 T C 17: 74,853,388 (GRCm39) V164A possibly damaging Het
Cdh26 T A 2: 178,110,022 (GRCm39) H438Q probably damaging Het
Cfap65 T A 1: 74,956,328 (GRCm39) K1084* probably null Het
Csmd1 T C 8: 15,950,676 (GRCm39) H3511R probably damaging Het
Ebf1 T A 11: 44,534,274 (GRCm39) S178T possibly damaging Het
Efcab3 A C 11: 104,811,135 (GRCm39) K3192N unknown Het
Eln A G 5: 134,755,375 (GRCm39) V226A unknown Het
Fat4 A T 3: 39,063,128 (GRCm39) probably null Het
Gcn1 C T 5: 115,717,698 (GRCm39) T222I probably benign Het
Gm5624 T G 14: 44,799,347 (GRCm39) N70T Het
Gpc6 T A 14: 118,129,761 (GRCm39) V387E possibly damaging Het
Gyg1 C T 3: 20,179,619 (GRCm39) V255M probably damaging Het
Henmt1 T A 3: 108,864,965 (GRCm39) F146I probably damaging Het
Itpr3 T A 17: 27,330,900 (GRCm39) L1736Q probably damaging Het
Kcnh4 A G 11: 100,640,619 (GRCm39) V469A possibly damaging Het
Mybpc2 A G 7: 44,157,729 (GRCm39) L750P probably damaging Het
Naalad2 A G 9: 18,241,939 (GRCm39) V655A probably damaging Het
Nme8 C T 13: 19,858,689 (GRCm39) D289N probably benign Het
Or12k5 T G 2: 36,895,402 (GRCm39) T75P probably damaging Het
Or2t6 A G 14: 14,175,416 (GRCm38) V222A probably benign Het
Or4c104 T A 2: 88,587,024 (GRCm39) probably benign Het
Or4k15 C G 14: 50,364,827 (GRCm39) S264R probably benign Het
Or5aq6 T C 2: 86,923,502 (GRCm39) K80E probably benign Het
Or8g30 T A 9: 39,230,401 (GRCm39) K170* probably null Het
Phf24 T A 4: 42,937,906 (GRCm39) C173* probably null Het
Plcb2 A G 2: 118,549,304 (GRCm39) F353L probably damaging Het
Prss33 C A 17: 24,052,930 (GRCm39) W248L probably damaging Het
Rgs3 T G 4: 62,544,254 (GRCm39) L350R possibly damaging Het
Samd11 C T 4: 156,333,730 (GRCm39) G200D probably damaging Het
Sh3tc2 T A 18: 62,123,873 (GRCm39) V878E probably damaging Het
Sh3tc2 G C 18: 62,148,142 (GRCm39) G1284A probably benign Het
Skint5 A G 4: 113,572,900 (GRCm39) S780P unknown Het
Slc8a3 T C 12: 81,361,452 (GRCm39) K456E probably damaging Het
Smok2a T A 17: 13,444,499 (GRCm39) H25Q probably benign Het
Srrt A G 5: 137,298,589 (GRCm39) L225P possibly damaging Het
Stox1 C T 10: 62,500,754 (GRCm39) R602Q probably damaging Het
Tmem30a A T 9: 79,683,507 (GRCm39) C157S probably damaging Het
Tnks1bp1 T C 2: 84,892,622 (GRCm39) S850P probably damaging Het
Trpm6 A G 19: 18,809,849 (GRCm39) I1082V probably benign Het
Ttll5 T A 12: 85,965,895 (GRCm39) N646K probably benign Het
Vmn1r179 A T 7: 23,628,277 (GRCm39) Y156F probably benign Het
Vmn1r54 T A 6: 90,246,413 (GRCm39) L109H probably damaging Het
Wdr17 T C 8: 55,115,953 (GRCm39) I617V probably benign Het
Zeb2 T A 2: 44,886,183 (GRCm39) Q958L probably damaging Het
Other mutations in Abca16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Abca16 APN 7 120,022,982 (GRCm39) missense probably benign 0.08
IGL00590:Abca16 APN 7 120,023,038 (GRCm39) missense probably damaging 1.00
IGL01320:Abca16 APN 7 120,038,422 (GRCm39) missense probably damaging 1.00
IGL01322:Abca16 APN 7 120,038,422 (GRCm39) missense probably damaging 1.00
IGL01613:Abca16 APN 7 120,140,500 (GRCm39) missense probably benign 0.03
IGL01774:Abca16 APN 7 120,021,024 (GRCm39) splice site probably benign
IGL01774:Abca16 APN 7 120,077,058 (GRCm39) missense probably damaging 1.00
IGL01797:Abca16 APN 7 120,113,760 (GRCm39) missense probably benign 0.15
IGL02406:Abca16 APN 7 120,139,825 (GRCm39) missense probably damaging 1.00
IGL02437:Abca16 APN 7 120,132,952 (GRCm39) missense probably benign 0.00
IGL02541:Abca16 APN 7 120,113,881 (GRCm39) missense possibly damaging 0.91
IGL02576:Abca16 APN 7 120,032,678 (GRCm39) missense probably benign 0.05
IGL02578:Abca16 APN 7 120,023,179 (GRCm39) critical splice donor site probably null
IGL03156:Abca16 APN 7 120,023,074 (GRCm39) missense possibly damaging 0.69
IGL03381:Abca16 APN 7 120,127,041 (GRCm39) missense probably benign 0.12
PIT4802001:Abca16 UTSW 7 120,139,351 (GRCm39) missense probably benign 0.31
R0024:Abca16 UTSW 7 120,032,608 (GRCm39) missense probably damaging 1.00
R0026:Abca16 UTSW 7 120,077,146 (GRCm39) splice site probably benign
R0026:Abca16 UTSW 7 120,077,146 (GRCm39) splice site probably benign
R0123:Abca16 UTSW 7 120,139,378 (GRCm39) missense probably damaging 1.00
R0134:Abca16 UTSW 7 120,139,378 (GRCm39) missense probably damaging 1.00
R0225:Abca16 UTSW 7 120,139,378 (GRCm39) missense probably damaging 1.00
R0346:Abca16 UTSW 7 120,035,155 (GRCm39) missense probably damaging 1.00
R0355:Abca16 UTSW 7 120,023,021 (GRCm39) missense possibly damaging 0.68
R0358:Abca16 UTSW 7 120,143,939 (GRCm39) missense probably benign 0.01
R0525:Abca16 UTSW 7 120,065,033 (GRCm39) nonsense probably null
R0617:Abca16 UTSW 7 120,032,834 (GRCm39) splice site probably benign
R0625:Abca16 UTSW 7 120,035,116 (GRCm39) missense probably damaging 1.00
R0835:Abca16 UTSW 7 120,065,007 (GRCm39) missense probably benign 0.42
R1445:Abca16 UTSW 7 120,119,256 (GRCm39) missense probably benign 0.41
R1535:Abca16 UTSW 7 120,139,928 (GRCm39) missense probably benign 0.30
R1567:Abca16 UTSW 7 120,030,352 (GRCm39) missense probably benign 0.08
R1694:Abca16 UTSW 7 120,119,307 (GRCm39) missense probably damaging 1.00
R1860:Abca16 UTSW 7 120,133,986 (GRCm39) missense probably benign 0.02
R1876:Abca16 UTSW 7 120,032,608 (GRCm39) missense probably damaging 1.00
R1913:Abca16 UTSW 7 120,140,463 (GRCm39) missense probably benign 0.04
R1940:Abca16 UTSW 7 120,032,832 (GRCm39) splice site probably benign
R2042:Abca16 UTSW 7 120,143,941 (GRCm39) missense probably benign
R2115:Abca16 UTSW 7 120,139,868 (GRCm39) missense probably damaging 1.00
R2122:Abca16 UTSW 7 120,119,184 (GRCm39) missense probably damaging 1.00
R2265:Abca16 UTSW 7 120,030,383 (GRCm39) missense probably benign 0.03
R2267:Abca16 UTSW 7 120,030,383 (GRCm39) missense probably benign 0.03
R2269:Abca16 UTSW 7 120,030,383 (GRCm39) missense probably benign 0.03
R2993:Abca16 UTSW 7 120,134,384 (GRCm39) missense probably damaging 1.00
R3055:Abca16 UTSW 7 120,035,074 (GRCm39) missense probably benign 0.05
R3956:Abca16 UTSW 7 120,126,975 (GRCm39) missense probably damaging 0.96
R4114:Abca16 UTSW 7 120,126,290 (GRCm39) missense probably benign 0.06
R4441:Abca16 UTSW 7 120,127,024 (GRCm39) missense probably benign 0.04
R4601:Abca16 UTSW 7 120,035,920 (GRCm39) missense probably damaging 0.98
R4706:Abca16 UTSW 7 120,064,988 (GRCm39) missense probably damaging 1.00
R4807:Abca16 UTSW 7 120,139,832 (GRCm39) missense probably damaging 1.00
R4824:Abca16 UTSW 7 120,074,702 (GRCm39) missense possibly damaging 0.86
R4937:Abca16 UTSW 7 120,126,309 (GRCm39) missense probably damaging 0.98
R5152:Abca16 UTSW 7 120,139,846 (GRCm39) missense probably benign 0.02
R5257:Abca16 UTSW 7 120,035,992 (GRCm39) critical splice donor site probably null
R5258:Abca16 UTSW 7 120,035,992 (GRCm39) critical splice donor site probably null
R5330:Abca16 UTSW 7 120,102,600 (GRCm39) missense probably benign 0.15
R5388:Abca16 UTSW 7 120,139,969 (GRCm39) critical splice donor site probably null
R5590:Abca16 UTSW 7 120,143,995 (GRCm39) missense probably damaging 0.98
R5810:Abca16 UTSW 7 120,035,155 (GRCm39) missense probably damaging 1.00
R6030:Abca16 UTSW 7 120,133,021 (GRCm39) missense probably benign
R6030:Abca16 UTSW 7 120,133,021 (GRCm39) missense probably benign
R6161:Abca16 UTSW 7 120,139,934 (GRCm39) missense probably damaging 1.00
R6313:Abca16 UTSW 7 120,126,344 (GRCm39) missense probably damaging 1.00
R6485:Abca16 UTSW 7 120,026,390 (GRCm39) nonsense probably null
R6527:Abca16 UTSW 7 120,076,995 (GRCm39) missense possibly damaging 0.95
R6772:Abca16 UTSW 7 120,126,276 (GRCm39) missense probably damaging 1.00
R6885:Abca16 UTSW 7 120,119,332 (GRCm39) missense probably benign 0.07
R6899:Abca16 UTSW 7 120,126,264 (GRCm39) missense probably damaging 1.00
R6941:Abca16 UTSW 7 120,140,370 (GRCm39) missense probably damaging 1.00
R6990:Abca16 UTSW 7 120,126,950 (GRCm39) missense probably benign 0.00
R7059:Abca16 UTSW 7 120,020,971 (GRCm39) missense probably benign 0.00
R7144:Abca16 UTSW 7 120,032,796 (GRCm39) missense possibly damaging 0.89
R7146:Abca16 UTSW 7 120,126,974 (GRCm39) missense possibly damaging 0.46
R7193:Abca16 UTSW 7 120,026,409 (GRCm39) missense probably damaging 1.00
R7308:Abca16 UTSW 7 120,022,993 (GRCm39) missense probably benign 0.01
R7449:Abca16 UTSW 7 120,035,131 (GRCm39) missense possibly damaging 0.95
R7571:Abca16 UTSW 7 120,119,211 (GRCm39) missense probably benign 0.11
R7617:Abca16 UTSW 7 120,102,694 (GRCm39) nonsense probably null
R7646:Abca16 UTSW 7 120,113,937 (GRCm39) missense probably benign 0.04
R7750:Abca16 UTSW 7 120,113,928 (GRCm39) missense probably benign 0.09
R7763:Abca16 UTSW 7 120,113,825 (GRCm39) missense probably damaging 1.00
R7840:Abca16 UTSW 7 120,074,689 (GRCm39) missense probably benign 0.00
R7946:Abca16 UTSW 7 120,126,398 (GRCm39) missense probably benign 0.01
R8018:Abca16 UTSW 7 120,132,866 (GRCm39) missense probably benign 0.04
R8170:Abca16 UTSW 7 120,065,005 (GRCm39) missense probably damaging 1.00
R8461:Abca16 UTSW 7 120,035,918 (GRCm39) missense possibly damaging 0.95
R8858:Abca16 UTSW 7 120,052,327 (GRCm39) missense probably benign
R8881:Abca16 UTSW 7 120,074,794 (GRCm39) missense probably benign 0.18
R9272:Abca16 UTSW 7 120,076,993 (GRCm39) missense probably benign 0.13
R9303:Abca16 UTSW 7 120,126,989 (GRCm39) missense probably benign 0.25
R9305:Abca16 UTSW 7 120,126,989 (GRCm39) missense probably benign 0.25
R9320:Abca16 UTSW 7 120,139,320 (GRCm39) missense probably damaging 0.98
R9413:Abca16 UTSW 7 120,126,422 (GRCm39) missense probably benign 0.01
R9512:Abca16 UTSW 7 120,022,963 (GRCm39) missense probably benign 0.01
R9559:Abca16 UTSW 7 120,021,019 (GRCm39) critical splice donor site probably null
R9615:Abca16 UTSW 7 120,126,404 (GRCm39) missense probably benign 0.01
R9641:Abca16 UTSW 7 120,126,308 (GRCm39) missense possibly damaging 0.52
R9643:Abca16 UTSW 7 120,065,023 (GRCm39) missense possibly damaging 0.96
R9674:Abca16 UTSW 7 120,074,668 (GRCm39) critical splice acceptor site probably null
R9714:Abca16 UTSW 7 120,030,383 (GRCm39) missense probably benign 0.01
R9799:Abca16 UTSW 7 120,132,998 (GRCm39) missense probably benign 0.00
R9800:Abca16 UTSW 7 120,119,283 (GRCm39) missense possibly damaging 0.68
RF020:Abca16 UTSW 7 120,132,880 (GRCm39) missense possibly damaging 0.90
X0066:Abca16 UTSW 7 120,102,609 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAGAACTCTTGGCAGCTTTG -3'
(R):5'- ATTCAGAGATGATGCACCCAAC -3'

Sequencing Primer
(F):5'- AGCTTTGCTGTTTGTAATAATGTTG -3'
(R):5'- GTCTACCTTTGATAGTGGTG -3'
Posted On 2020-10-20