Mutagenetix > Incidental Mutation

Incidental Mutation 'R8413:Abca16'

652788

Institutional Source

Beutler Lab

Gene Symbol

Abca16

Ensembl Gene

ENSMUSG00000051900

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 16

Synonyms

MMRRC Submission

Accession Numbers

NCBI RefSeq: NM_001278943.1, NM_001278944.1; MGI:2388711

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8413 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

120409647-120544813 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 120423900 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 86 (D86E)

Ref Sequence

ENSEMBL: ENSMUSP00000112736 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056042] [ENSMUST00000120490]

AlphaFold

E9PWJ7

Predicted Effect

probably benign
Transcript: ENSMUST00000056042
AA Change: D86E

PolyPhen 2 Score 0.243 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000061094
Gene: ENSMUSG00000051900
AA Change: D86E

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	26	455	2.7e-23	PFAM
AAA	537	720	2.01e-7	SMART
Pfam:ABC2_membrane_3	898	1287	4.6e-25	PFAM
low complexity region	1325	1336	N/A	INTRINSIC
low complexity region	1342	1353	N/A	INTRINSIC
AAA	1378	1563	4.23e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000120490
AA Change: D86E

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000112736
Gene: ENSMUSG00000051900
AA Change: D86E

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	25	456	2.4e-22	PFAM
AAA	538	721	2.01e-7	SMART
Pfam:ABC2_membrane_3	899	1288	1.1e-27	PFAM
low complexity region	1326	1337	N/A	INTRINSIC
low complexity region	1343	1354	N/A	INTRINSIC
AAA	1379	1564	4.23e-6	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts5	A	G	16: 85,866,618		probably null	Het
Arhgap31	T	C	16: 38,602,921	R928G	possibly damaging	Het
Birc6	T	C	17: 74,546,393	V164A	possibly damaging	Het
Cdh26	T	A	2: 178,468,229	H438Q	probably damaging	Het
Cfap65	T	A	1: 74,917,169	K1084*	probably null	Het
Csmd1	T	C	8: 15,900,676	H3511R	probably damaging	Het
Ebf1	T	A	11: 44,643,447	S178T	possibly damaging	Het
Eln	A	G	5: 134,726,521	V226A	unknown	Het
Fat4	A	T	3: 39,008,979		probably null	Het
Gcn1l1	C	T	5: 115,579,639	T222I	probably benign	Het
Gm11639	A	C	11: 104,920,309	K3192N	unknown	Het
Gm5624	T	G	14: 44,561,890	N70T		Het
Gpc6	T	A	14: 117,892,349	V387E	possibly damaging	Het
Gyg	C	T	3: 20,125,455	V255M	probably damaging	Het
Henmt1	T	A	3: 108,957,649	F146I	probably damaging	Het
Itpr3	T	A	17: 27,111,926	L1736Q	probably damaging	Het
Kcnh4	A	G	11: 100,749,793	V469A	possibly damaging	Het
Mybpc2	A	G	7: 44,508,305	L750P	probably damaging	Het
Naalad2	A	G	9: 18,330,643	V655A	probably damaging	Het
Nme8	C	T	13: 19,674,519	D289N	probably benign	Het
Olfr1109	T	C	2: 87,093,158	K80E	probably benign	Het
Olfr1199	T	A	2: 88,756,680		probably benign	Het
Olfr358	T	G	2: 37,005,390	T75P	probably damaging	Het
Olfr720	A	G	14: 14,175,416	V222A	probably benign	Het
Olfr727	C	G	14: 50,127,370	S264R	probably benign	Het
Olfr948	T	A	9: 39,319,105	K170*	probably null	Het
Phf24	T	A	4: 42,937,906	C173*	probably null	Het
Plcb2	A	G	2: 118,718,823	F353L	probably damaging	Het
Prss33	C	A	17: 23,833,956	W248L	probably damaging	Het
Rgs3	T	G	4: 62,626,017	L350R	possibly damaging	Het
Samd11	C	T	4: 156,249,273	G200D	probably damaging	Het
Sh3tc2	T	A	18: 61,990,802	V878E	probably damaging	Het
Sh3tc2	G	C	18: 62,015,071	G1284A	probably benign	Het
Skint5	A	G	4: 113,715,703	S780P	unknown	Het
Slc8a3	T	C	12: 81,314,678	K456E	probably damaging	Het
Smok2a	T	A	17: 13,225,612	H25Q	probably benign	Het
Srrt	A	G	5: 137,300,327	L225P	possibly damaging	Het
Stox1	C	T	10: 62,664,975	R602Q	probably damaging	Het
Tmem30a	A	T	9: 79,776,225	C157S	probably damaging	Het
Tnks1bp1	T	C	2: 85,062,278	S850P	probably damaging	Het
Trpm6	A	G	19: 18,832,485	I1082V	probably benign	Het
Ttll5	T	A	12: 85,919,121	N646K	probably benign	Het
Vmn1r179	A	T	7: 23,928,852	Y156F	probably benign	Het
Vmn1r54	T	A	6: 90,269,431	L109H	probably damaging	Het
Wdr17	T	C	8: 54,662,918	I617V	probably benign	Het
Zeb2	T	A	2: 44,996,171	Q958L	probably damaging	Het

Other mutations in Abca16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00417:Abca16	APN	7	120423759	missense	probably benign	0.08
IGL00590:Abca16	APN	7	120423815	missense	probably damaging	1.00
IGL01320:Abca16	APN	7	120439199	missense	probably damaging	1.00
IGL01322:Abca16	APN	7	120439199	missense	probably damaging	1.00
IGL01613:Abca16	APN	7	120541277	missense	probably benign	0.03
IGL01774:Abca16	APN	7	120477835	missense	probably damaging	1.00
IGL01774:Abca16	APN	7	120421801	splice site	probably benign
IGL01797:Abca16	APN	7	120514537	missense	probably benign	0.15
IGL02406:Abca16	APN	7	120540602	missense	probably damaging	1.00
IGL02437:Abca16	APN	7	120533729	missense	probably benign	0.00
IGL02541:Abca16	APN	7	120514658	missense	possibly damaging	0.91
IGL02576:Abca16	APN	7	120433455	missense	probably benign	0.05
IGL02578:Abca16	APN	7	120423956	critical splice donor site	probably null
IGL03156:Abca16	APN	7	120423851	missense	possibly damaging	0.69
IGL03381:Abca16	APN	7	120527818	missense	probably benign	0.12
PIT4802001:Abca16	UTSW	7	120540128	missense	probably benign	0.31
R0024:Abca16	UTSW	7	120433385	missense	probably damaging	1.00
R0026:Abca16	UTSW	7	120477923	splice site	probably benign
R0026:Abca16	UTSW	7	120477923	splice site	probably benign
R0123:Abca16	UTSW	7	120540155	missense	probably damaging	1.00
R0134:Abca16	UTSW	7	120540155	missense	probably damaging	1.00
R0225:Abca16	UTSW	7	120540155	missense	probably damaging	1.00
R0346:Abca16	UTSW	7	120435932	missense	probably damaging	1.00
R0355:Abca16	UTSW	7	120423798	missense	possibly damaging	0.68
R0358:Abca16	UTSW	7	120544716	missense	probably benign	0.01
R0525:Abca16	UTSW	7	120465810	nonsense	probably null
R0617:Abca16	UTSW	7	120433611	splice site	probably benign
R0625:Abca16	UTSW	7	120435893	missense	probably damaging	1.00
R0835:Abca16	UTSW	7	120465784	missense	probably benign	0.42
R1445:Abca16	UTSW	7	120520033	missense	probably benign	0.41
R1535:Abca16	UTSW	7	120540705	missense	probably benign	0.30
R1567:Abca16	UTSW	7	120431129	missense	probably benign	0.08
R1694:Abca16	UTSW	7	120520084	missense	probably damaging	1.00
R1860:Abca16	UTSW	7	120534763	missense	probably benign	0.02
R1876:Abca16	UTSW	7	120433385	missense	probably damaging	1.00
R1913:Abca16	UTSW	7	120541240	missense	probably benign	0.04
R1940:Abca16	UTSW	7	120433609	splice site	probably benign
R2042:Abca16	UTSW	7	120544718	missense	probably benign
R2115:Abca16	UTSW	7	120540645	missense	probably damaging	1.00
R2122:Abca16	UTSW	7	120519961	missense	probably damaging	1.00
R2265:Abca16	UTSW	7	120431160	missense	probably benign	0.03
R2267:Abca16	UTSW	7	120431160	missense	probably benign	0.03
R2269:Abca16	UTSW	7	120431160	missense	probably benign	0.03
R2993:Abca16	UTSW	7	120535161	missense	probably damaging	1.00
R3055:Abca16	UTSW	7	120435851	missense	probably benign	0.05
R3956:Abca16	UTSW	7	120527752	missense	probably damaging	0.96
R4114:Abca16	UTSW	7	120527067	missense	probably benign	0.06
R4441:Abca16	UTSW	7	120527801	missense	probably benign	0.04
R4601:Abca16	UTSW	7	120436697	missense	probably damaging	0.98
R4706:Abca16	UTSW	7	120465765	missense	probably damaging	1.00
R4807:Abca16	UTSW	7	120540609	missense	probably damaging	1.00
R4824:Abca16	UTSW	7	120475479	missense	possibly damaging	0.86
R4937:Abca16	UTSW	7	120527086	missense	probably damaging	0.98
R5152:Abca16	UTSW	7	120540623	missense	probably benign	0.02
R5257:Abca16	UTSW	7	120436769	critical splice donor site	probably null
R5258:Abca16	UTSW	7	120436769	critical splice donor site	probably null
R5330:Abca16	UTSW	7	120503377	missense	probably benign	0.15
R5388:Abca16	UTSW	7	120540746	critical splice donor site	probably null
R5590:Abca16	UTSW	7	120544772	missense	probably damaging	0.98
R5810:Abca16	UTSW	7	120435932	missense	probably damaging	1.00
R6030:Abca16	UTSW	7	120533798	missense	probably benign
R6030:Abca16	UTSW	7	120533798	missense	probably benign
R6161:Abca16	UTSW	7	120540711	missense	probably damaging	1.00
R6313:Abca16	UTSW	7	120527121	missense	probably damaging	1.00
R6485:Abca16	UTSW	7	120427167	nonsense	probably null
R6527:Abca16	UTSW	7	120477772	missense	possibly damaging	0.95
R6772:Abca16	UTSW	7	120527053	missense	probably damaging	1.00
R6885:Abca16	UTSW	7	120520109	missense	probably benign	0.07
R6899:Abca16	UTSW	7	120527041	missense	probably damaging	1.00
R6941:Abca16	UTSW	7	120541147	missense	probably damaging	1.00
R6990:Abca16	UTSW	7	120527727	missense	probably benign	0.00
R7059:Abca16	UTSW	7	120421748	missense	probably benign	0.00
R7144:Abca16	UTSW	7	120433573	missense	possibly damaging	0.89
R7146:Abca16	UTSW	7	120527751	missense	possibly damaging	0.46
R7193:Abca16	UTSW	7	120427186	missense	probably damaging	1.00
R7308:Abca16	UTSW	7	120423770	missense	probably benign	0.01
R7449:Abca16	UTSW	7	120435908	missense	possibly damaging	0.95
R7571:Abca16	UTSW	7	120519988	missense	probably benign	0.11
R7617:Abca16	UTSW	7	120503471	nonsense	probably null
R7646:Abca16	UTSW	7	120514714	missense	probably benign	0.04
R7750:Abca16	UTSW	7	120514705	missense	probably benign	0.09
R7763:Abca16	UTSW	7	120514602	missense	probably damaging	1.00
R7840:Abca16	UTSW	7	120475466	missense	probably benign	0.00
R7946:Abca16	UTSW	7	120527175	missense	probably benign	0.01
R8018:Abca16	UTSW	7	120533643	missense	probably benign	0.04
R8170:Abca16	UTSW	7	120465782	missense	probably damaging	1.00
R8461:Abca16	UTSW	7	120436695	missense	possibly damaging	0.95
R8858:Abca16	UTSW	7	120453104	missense	probably benign
R8881:Abca16	UTSW	7	120475571	missense	probably benign	0.18
R9272:Abca16	UTSW	7	120477770	missense	probably benign	0.13
R9303:Abca16	UTSW	7	120527766	missense	probably benign	0.25
R9305:Abca16	UTSW	7	120527766	missense	probably benign	0.25
R9320:Abca16	UTSW	7	120540097	missense	probably damaging	0.98
R9413:Abca16	UTSW	7	120527199	missense	probably benign	0.01
R9512:Abca16	UTSW	7	120423740	missense	probably benign	0.01
R9559:Abca16	UTSW	7	120421796	critical splice donor site	probably null
R9615:Abca16	UTSW	7	120527181	missense	probably benign	0.01
R9641:Abca16	UTSW	7	120527085	missense	possibly damaging	0.52
R9643:Abca16	UTSW	7	120465800	missense	possibly damaging	0.96
R9674:Abca16	UTSW	7	120475445	critical splice acceptor site	probably null
R9714:Abca16	UTSW	7	120431160	missense	probably benign	0.01
R9799:Abca16	UTSW	7	120533775	missense	probably benign	0.00
R9800:Abca16	UTSW	7	120520060	missense	possibly damaging	0.68
RF020:Abca16	UTSW	7	120533657	missense	possibly damaging	0.90
X0066:Abca16	UTSW	7	120503386	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GCAGAACTCTTGGCAGCTTTG -3'
(R):5'- ATTCAGAGATGATGCACCCAAC -3'

Sequencing Primer
(F):5'- AGCTTTGCTGTTTGTAATAATGTTG -3'
(R):5'- GTCTACCTTTGATAGTGGTG -3'

Posted On

2020-10-20