Incidental Mutation 'R8413:Gm5624'
ID652802
Institutional Source Beutler Lab
Gene Symbol Gm5624
Ensembl Gene ENSMUSG00000092165
Gene Namepredicted gene 5624
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R8413 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location44556795-44627938 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 44561890 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 70 (N70T)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178184] [ENSMUST00000227882] [ENSMUST00000228629]
Predicted Effect
SMART Domains Protein: ENSMUSP00000126636
Gene: ENSMUSG00000092165
AA Change: N70T

DomainStartEndE-ValueType
Pfam:Takusan 57 137 1.2e-27 PFAM
coiled coil region 152 185 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178184
AA Change: N27T

PolyPhen 2 Score 0.429 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000136815
Gene: ENSMUSG00000092165
AA Change: N27T

DomainStartEndE-ValueType
Pfam:Takusan 13 93 2.2e-27 PFAM
coiled coil region 109 142 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000227882
AA Change: N26T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000228629
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T A 7: 120,423,900 D86E probably benign Het
Adamts5 A G 16: 85,866,618 probably null Het
Arhgap31 T C 16: 38,602,921 R928G possibly damaging Het
Birc6 T C 17: 74,546,393 V164A possibly damaging Het
Cdh26 T A 2: 178,468,229 H438Q probably damaging Het
Cfap65 T A 1: 74,917,169 K1084* probably null Het
Csmd1 T C 8: 15,900,676 H3511R probably damaging Het
Ebf1 T A 11: 44,643,447 S178T possibly damaging Het
Eln A G 5: 134,726,521 V226A unknown Het
Fat4 A T 3: 39,008,979 probably null Het
Gcn1l1 C T 5: 115,579,639 T222I probably benign Het
Gm11639 A C 11: 104,920,309 K3192N unknown Het
Gpc6 T A 14: 117,892,349 V387E possibly damaging Het
Gyg C T 3: 20,125,455 V255M probably damaging Het
Henmt1 T A 3: 108,957,649 F146I probably damaging Het
Itpr3 T A 17: 27,111,926 L1736Q probably damaging Het
Kcnh4 A G 11: 100,749,793 V469A possibly damaging Het
Mybpc2 A G 7: 44,508,305 L750P probably damaging Het
Naalad2 A G 9: 18,330,643 V655A probably damaging Het
Nme8 C T 13: 19,674,519 D289N probably benign Het
Olfr1109 T C 2: 87,093,158 K80E probably benign Het
Olfr1199 T A 2: 88,756,680 probably benign Het
Olfr358 T G 2: 37,005,390 T75P probably damaging Het
Olfr720 A G 14: 14,175,416 V222A probably benign Het
Olfr727 C G 14: 50,127,370 S264R probably benign Het
Olfr948 T A 9: 39,319,105 K170* probably null Het
Phf24 T A 4: 42,937,906 C173* probably null Het
Plcb2 A G 2: 118,718,823 F353L probably damaging Het
Prss33 C A 17: 23,833,956 W248L probably damaging Het
Rgs3 T G 4: 62,626,017 L350R possibly damaging Het
Samd11 C T 4: 156,249,273 G200D probably damaging Het
Sh3tc2 G C 18: 62,015,071 G1284A probably benign Het
Sh3tc2 T A 18: 61,990,802 V878E probably damaging Het
Skint5 A G 4: 113,715,703 S780P unknown Het
Slc8a3 T C 12: 81,314,678 K456E probably damaging Het
Smok2a T A 17: 13,225,612 H25Q probably benign Het
Srrt A G 5: 137,300,327 L225P possibly damaging Het
Stox1 C T 10: 62,664,975 R602Q probably damaging Het
Tmem30a A T 9: 79,776,225 C157S probably damaging Het
Tnks1bp1 T C 2: 85,062,278 S850P probably damaging Het
Trpm6 A G 19: 18,832,485 I1082V probably benign Het
Ttll5 T A 12: 85,919,121 N646K probably benign Het
Vmn1r179 A T 7: 23,928,852 Y156F probably benign Het
Vmn1r54 T A 6: 90,269,431 L109H probably damaging Het
Wdr17 T C 8: 54,662,918 I617V probably benign Het
Zeb2 T A 2: 44,996,171 Q958L probably damaging Het
Other mutations in Gm5624
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02502:Gm5624 APN 14 44559839 critical splice donor site probably null
IGL02682:Gm5624 APN 14 44560012 missense possibly damaging 0.86
IGL03145:Gm5624 APN 14 44560765 missense possibly damaging 0.50
IGL03212:Gm5624 APN 14 44560710 missense probably benign 0.01
R1800:Gm5624 UTSW 14 44561845 missense probably damaging 1.00
R6136:Gm5624 UTSW 14 44559876 missense probably benign 0.17
R6727:Gm5624 UTSW 14 44561875 missense possibly damaging 0.52
R7512:Gm5624 UTSW 14 44561855 missense
R7662:Gm5624 UTSW 14 44561933 missense possibly damaging 0.94
R7950:Gm5624 UTSW 14 44560733 missense
R8411:Gm5624 UTSW 14 44561890 missense
Predicted Primers PCR Primer
(F):5'- TGAGAGATGACACACTCCATTC -3'
(R):5'- CCAGCTCAAATATAGCCTTTCTGC -3'

Sequencing Primer
(F):5'- CACTCCATTCATAGGAGAAAATGTGG -3'
(R):5'- AATATAGCCTTTCTGCTTTTTCAGTG -3'
Posted On2020-10-20