Incidental Mutation 'R8413:Gm5624'
ID 652802
Institutional Source Beutler Lab
Gene Symbol Gm5624
Ensembl Gene ENSMUSG00000092165
Gene Name predicted gene 5624
Synonyms
MMRRC Submission 067767-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.151) question?
Stock # R8413 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 44794603-44865381 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 44799347 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Threonine at position 70 (N70T)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178184] [ENSMUST00000227882] [ENSMUST00000228629]
AlphaFold J3QK24
Predicted Effect
SMART Domains Protein: ENSMUSP00000126636
Gene: ENSMUSG00000092165
AA Change: N70T

DomainStartEndE-ValueType
Pfam:Takusan 57 137 1.2e-27 PFAM
coiled coil region 152 185 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178184
AA Change: N27T

PolyPhen 2 Score 0.429 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000136815
Gene: ENSMUSG00000092165
AA Change: N27T

DomainStartEndE-ValueType
Pfam:Takusan 13 93 2.2e-27 PFAM
coiled coil region 109 142 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000227882
AA Change: N26T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000228629
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T A 7: 120,023,123 (GRCm39) D86E probably benign Het
Adamts5 A G 16: 85,663,506 (GRCm39) probably null Het
Arhgap31 T C 16: 38,423,283 (GRCm39) R928G possibly damaging Het
Birc6 T C 17: 74,853,388 (GRCm39) V164A possibly damaging Het
Cdh26 T A 2: 178,110,022 (GRCm39) H438Q probably damaging Het
Cfap65 T A 1: 74,956,328 (GRCm39) K1084* probably null Het
Csmd1 T C 8: 15,950,676 (GRCm39) H3511R probably damaging Het
Ebf1 T A 11: 44,534,274 (GRCm39) S178T possibly damaging Het
Efcab3 A C 11: 104,811,135 (GRCm39) K3192N unknown Het
Eln A G 5: 134,755,375 (GRCm39) V226A unknown Het
Fat4 A T 3: 39,063,128 (GRCm39) probably null Het
Gcn1 C T 5: 115,717,698 (GRCm39) T222I probably benign Het
Gpc6 T A 14: 118,129,761 (GRCm39) V387E possibly damaging Het
Gyg1 C T 3: 20,179,619 (GRCm39) V255M probably damaging Het
Henmt1 T A 3: 108,864,965 (GRCm39) F146I probably damaging Het
Itpr3 T A 17: 27,330,900 (GRCm39) L1736Q probably damaging Het
Kcnh4 A G 11: 100,640,619 (GRCm39) V469A possibly damaging Het
Mybpc2 A G 7: 44,157,729 (GRCm39) L750P probably damaging Het
Naalad2 A G 9: 18,241,939 (GRCm39) V655A probably damaging Het
Nme8 C T 13: 19,858,689 (GRCm39) D289N probably benign Het
Or12k5 T G 2: 36,895,402 (GRCm39) T75P probably damaging Het
Or2t6 A G 14: 14,175,416 (GRCm38) V222A probably benign Het
Or4c104 T A 2: 88,587,024 (GRCm39) probably benign Het
Or4k15 C G 14: 50,364,827 (GRCm39) S264R probably benign Het
Or5aq6 T C 2: 86,923,502 (GRCm39) K80E probably benign Het
Or8g30 T A 9: 39,230,401 (GRCm39) K170* probably null Het
Phf24 T A 4: 42,937,906 (GRCm39) C173* probably null Het
Plcb2 A G 2: 118,549,304 (GRCm39) F353L probably damaging Het
Prss33 C A 17: 24,052,930 (GRCm39) W248L probably damaging Het
Rgs3 T G 4: 62,544,254 (GRCm39) L350R possibly damaging Het
Samd11 C T 4: 156,333,730 (GRCm39) G200D probably damaging Het
Sh3tc2 T A 18: 62,123,873 (GRCm39) V878E probably damaging Het
Sh3tc2 G C 18: 62,148,142 (GRCm39) G1284A probably benign Het
Skint5 A G 4: 113,572,900 (GRCm39) S780P unknown Het
Slc8a3 T C 12: 81,361,452 (GRCm39) K456E probably damaging Het
Smok2a T A 17: 13,444,499 (GRCm39) H25Q probably benign Het
Srrt A G 5: 137,298,589 (GRCm39) L225P possibly damaging Het
Stox1 C T 10: 62,500,754 (GRCm39) R602Q probably damaging Het
Tmem30a A T 9: 79,683,507 (GRCm39) C157S probably damaging Het
Tnks1bp1 T C 2: 84,892,622 (GRCm39) S850P probably damaging Het
Trpm6 A G 19: 18,809,849 (GRCm39) I1082V probably benign Het
Ttll5 T A 12: 85,965,895 (GRCm39) N646K probably benign Het
Vmn1r179 A T 7: 23,628,277 (GRCm39) Y156F probably benign Het
Vmn1r54 T A 6: 90,246,413 (GRCm39) L109H probably damaging Het
Wdr17 T C 8: 55,115,953 (GRCm39) I617V probably benign Het
Zeb2 T A 2: 44,886,183 (GRCm39) Q958L probably damaging Het
Other mutations in Gm5624
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02502:Gm5624 APN 14 44,797,296 (GRCm39) critical splice donor site probably null
IGL02682:Gm5624 APN 14 44,797,469 (GRCm39) missense possibly damaging 0.86
IGL03145:Gm5624 APN 14 44,798,222 (GRCm39) missense possibly damaging 0.50
IGL03212:Gm5624 APN 14 44,798,167 (GRCm39) missense probably benign 0.01
R1800:Gm5624 UTSW 14 44,799,302 (GRCm39) missense probably damaging 1.00
R6136:Gm5624 UTSW 14 44,797,333 (GRCm39) missense probably benign 0.17
R6727:Gm5624 UTSW 14 44,799,332 (GRCm39) missense possibly damaging 0.52
R7512:Gm5624 UTSW 14 44,799,312 (GRCm39) missense
R7662:Gm5624 UTSW 14 44,799,390 (GRCm39) missense possibly damaging 0.94
R7950:Gm5624 UTSW 14 44,798,190 (GRCm39) missense
R8411:Gm5624 UTSW 14 44,799,347 (GRCm39) missense
R9355:Gm5624 UTSW 14 44,799,272 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAGAGATGACACACTCCATTC -3'
(R):5'- CCAGCTCAAATATAGCCTTTCTGC -3'

Sequencing Primer
(F):5'- CACTCCATTCATAGGAGAAAATGTGG -3'
(R):5'- AATATAGCCTTTCTGCTTTTTCAGTG -3'
Posted On 2020-10-20