Incidental Mutation 'R8414:Ugt3a1'
ID 652853
Institutional Source Beutler Lab
Gene Symbol Ugt3a1
Ensembl Gene ENSMUSG00000072664
Gene Name UDP glycosyltransferases 3 family, polypeptide A1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock # R8414 (G1)
Quality Score 129.008
Status Not validated
Chromosome 15
Chromosomal Location 9276888-9315032 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 9310583 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 317 (N317S)
Ref Sequence ENSEMBL: ENSMUSP00000022861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022861]
AlphaFold Q3UP75
Predicted Effect possibly damaging
Transcript: ENSMUST00000022861
AA Change: N317S

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022861
Gene: ENSMUSG00000072664
AA Change: N317S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:UDPGT 23 521 1.4e-98 PFAM
Pfam:Glyco_tran_28_C 300 451 3.7e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik A T 8: 84,167,323 E373V probably damaging Het
9530053A07Rik T A 7: 28,142,733 C698S probably damaging Het
AA467197 T C 2: 122,638,317 Y33H probably damaging Het
Abcc10 T C 17: 46,312,347 R880G probably benign Het
Abcg2 T A 6: 58,669,236 Y246N probably benign Het
Abhd18 A G 3: 40,933,626 M302V probably benign Het
Ablim2 A G 5: 35,874,891 D568G possibly damaging Het
Alpk2 T C 18: 65,307,471 R284G possibly damaging Het
AU021092 T C 16: 5,216,785 Y191C probably damaging Het
Bdp1 T A 13: 100,064,477 T751S probably benign Het
Ccdc136 A G 6: 29,412,930 E438G probably damaging Het
Cul2 C A 18: 3,399,912 N15K probably benign Het
Eml2 C A 7: 19,179,295 Q73K probably damaging Het
Epha6 C A 16: 60,005,667 R588S probably damaging Het
Eppk1 C T 15: 76,110,119 R854Q probably benign Het
Fbxw28 C T 9: 109,326,536 W389* probably null Het
Gbp4 A T 5: 105,136,837 V62E probably benign Het
Gm30302 A G 13: 49,787,797 S56P probably damaging Het
Gtf2h1 C A 7: 46,815,344 T401K possibly damaging Het
Hif1a G T 12: 73,937,654 M294I probably benign Het
Irak2 A G 6: 113,686,942 N484S probably benign Het
Kcnj16 A G 11: 111,025,615 T368A probably benign Het
Kcnq1 G A 7: 143,363,666 G588D probably damaging Het
Kcnq5 G A 1: 21,479,424 R360C probably damaging Het
Nckap5 T G 1: 126,014,620 E1582D probably damaging Het
Nrip3 A G 7: 109,763,528 I183T possibly damaging Het
Olfr1222 A G 2: 89,125,714 F6L probably benign Het
Olfr979 T A 9: 40,000,945 H94L probably benign Het
Pcdha2 C T 18: 36,941,566 S750L probably damaging Het
Pik3r2 T C 8: 70,770,435 Y447C probably damaging Het
Poteg T C 8: 27,448,040 Y75H probably benign Het
Proser1 G C 3: 53,478,556 G620R probably damaging Het
Prpsap1 A T 11: 116,478,613 L164H probably damaging Het
Rfc3 A T 5: 151,644,916 V195E possibly damaging Het
Sarm1 A T 11: 78,487,968 V417D probably damaging Het
She A G 3: 89,831,867 T122A probably benign Het
Srpr A G 9: 35,214,837 E442G probably benign Het
Sult2a6 T A 7: 14,250,432 R124S probably damaging Het
Synm T C 7: 67,733,763 T1384A probably benign Het
Tenm3 A G 8: 48,293,509 V1087A probably damaging Het
Ticam1 T A 17: 56,271,340 I252L probably benign Het
Trbv31 C A 6: 41,557,763 D89Y possibly damaging Het
Trpc7 G A 13: 56,822,469 T434I probably benign Het
Tubgcp4 T A 2: 121,194,153 I603N probably benign Het
Vdac1 C T 11: 52,376,503 T77I possibly damaging Het
Vmn2r113 A T 17: 22,958,779 R846* probably null Het
Zc3h12d GCCC GCC 10: 7,839,971 probably null Het
Zranb2 G T 3: 157,546,675 R310S unknown Het
Other mutations in Ugt3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00912:Ugt3a1 APN 15 9310612 missense probably damaging 1.00
IGL01752:Ugt3a1 APN 15 9306146 missense probably damaging 1.00
IGL02438:Ugt3a1 APN 15 9291976 missense possibly damaging 0.90
PIT4354001:Ugt3a1 UTSW 15 9306360 nonsense probably null
R0127:Ugt3a1 UTSW 15 9306256 missense probably benign 0.01
R0647:Ugt3a1 UTSW 15 9310549 missense probably benign 0.00
R0841:Ugt3a1 UTSW 15 9306128 missense probably benign 0.07
R1395:Ugt3a1 UTSW 15 9306292 missense possibly damaging 0.92
R1616:Ugt3a1 UTSW 15 9306244 nonsense probably null
R2338:Ugt3a1 UTSW 15 9291973 splice site probably benign
R3797:Ugt3a1 UTSW 15 9310641 nonsense probably null
R4305:Ugt3a1 UTSW 15 9306274 missense possibly damaging 0.92
R4385:Ugt3a1 UTSW 15 9306479 missense probably benign 0.15
R4572:Ugt3a1 UTSW 15 9306393 missense probably benign 0.00
R4611:Ugt3a1 UTSW 15 9306400 nonsense probably null
R4744:Ugt3a1 UTSW 15 9310553 missense probably benign 0.36
R5715:Ugt3a1 UTSW 15 9306344 missense probably damaging 0.96
R6036:Ugt3a1 UTSW 15 9306086 missense probably benign 0.01
R6036:Ugt3a1 UTSW 15 9306086 missense probably benign 0.01
R6156:Ugt3a1 UTSW 15 9310676 missense possibly damaging 0.83
R6228:Ugt3a1 UTSW 15 9310640 missense possibly damaging 0.81
R6344:Ugt3a1 UTSW 15 9306231 missense probably damaging 0.98
R6380:Ugt3a1 UTSW 15 9306455 missense probably benign 0.00
R6383:Ugt3a1 UTSW 15 9306455 missense probably benign 0.00
R6737:Ugt3a1 UTSW 15 9311809 missense probably benign 0.30
R6848:Ugt3a1 UTSW 15 9280052 splice site probably null
R6937:Ugt3a1 UTSW 15 9292072 missense probably benign 0.00
R7061:Ugt3a1 UTSW 15 9306154 missense probably benign 0.12
R7672:Ugt3a1 UTSW 15 9310693 nonsense probably null
R7840:Ugt3a1 UTSW 15 9311817 missense probably damaging 1.00
R7945:Ugt3a1 UTSW 15 9284175 critical splice donor site probably null
R8105:Ugt3a1 UTSW 15 9306390 missense probably benign 0.00
R8981:Ugt3a1 UTSW 15 9311928 missense probably benign 0.20
R9111:Ugt3a1 UTSW 15 9306247 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- AGCCTGTTTTCGTGTCATGC -3'
(R):5'- TGTGATTGCTTGCCTCCTAG -3'

Sequencing Primer
(F):5'- ATGCTGCTTTGGCCTTTACAAAC -3'
(R):5'- TGCCAGTCCAAGTGTTCAGAC -3'
Posted On 2020-10-20