Incidental Mutation 'R8414:Ticam1'
ID652859
Institutional Source Beutler Lab
Gene Symbol Ticam1
Ensembl Gene ENSMUSG00000047123
Gene Nametoll-like receptor adaptor molecule 1
SynonymsTICAM-1, Trif
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8414 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location56269319-56276786 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 56271340 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 252 (I252L)
Ref Sequence ENSEMBL: ENSMUSP00000055104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058136]
Predicted Effect probably benign
Transcript: ENSMUST00000058136
AA Change: I252L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000055104
Gene: ENSMUSG00000047123
AA Change: I252L

DomainStartEndE-ValueType
PDB:4BSX|D 5 153 3e-52 PDB
low complexity region 345 384 N/A INTRINSIC
SCOP:d1fyva_ 386 491 8e-3 SMART
PDB:2M1X|A 391 547 1e-74 PDB
Pfam:RHIM 610 698 4.7e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adaptor protein containing a Toll/interleukin-1 receptor (TIR) homology domain, which is an intracellular signaling domain that mediates protein-protein interactions between the Toll-like receptors (TLRs) and signal-transduction components. This protein is involved in native immunity against invading pathogens. It specifically interacts with toll-like receptor 3, but not with other TLRs, and this association mediates dsRNA induction of interferon-beta through activation of nuclear factor kappa-B, during an antiviral immune response. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null mice are viable but exhibit abnormalities of the innate immune system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik A T 8: 84,167,323 E373V probably damaging Het
9530053A07Rik T A 7: 28,142,733 C698S probably damaging Het
AA467197 T C 2: 122,638,317 Y33H probably damaging Het
Abcc10 T C 17: 46,312,347 R880G probably benign Het
Abcg2 T A 6: 58,669,236 Y246N probably benign Het
Abhd18 A G 3: 40,933,626 M302V probably benign Het
Ablim2 A G 5: 35,874,891 D568G possibly damaging Het
Alpk2 T C 18: 65,307,471 R284G possibly damaging Het
AU021092 T C 16: 5,216,785 Y191C probably damaging Het
Bdp1 T A 13: 100,064,477 T751S probably benign Het
Ccdc136 A G 6: 29,412,930 E438G probably damaging Het
Cul2 C A 18: 3,399,912 N15K probably benign Het
Eml2 C A 7: 19,179,295 Q73K probably damaging Het
Epha6 C A 16: 60,005,667 R588S probably damaging Het
Eppk1 C T 15: 76,110,119 R854Q probably benign Het
Fbxw28 C T 9: 109,326,536 W389* probably null Het
Gbp4 A T 5: 105,136,837 V62E probably benign Het
Gm30302 A G 13: 49,787,797 S56P probably damaging Het
Gtf2h1 C A 7: 46,815,344 T401K possibly damaging Het
Hif1a G T 12: 73,937,654 M294I probably benign Het
Irak2 A G 6: 113,686,942 N484S probably benign Het
Kcnj16 A G 11: 111,025,615 T368A probably benign Het
Kcnq1 G A 7: 143,363,666 G588D probably damaging Het
Kcnq5 G A 1: 21,479,424 R360C probably damaging Het
Nckap5 T G 1: 126,014,620 E1582D probably damaging Het
Nrip3 A G 7: 109,763,528 I183T possibly damaging Het
Olfr1222 A G 2: 89,125,714 F6L probably benign Het
Olfr979 T A 9: 40,000,945 H94L probably benign Het
Pcdha2 C T 18: 36,941,566 S750L probably damaging Het
Pik3r2 T C 8: 70,770,435 Y447C probably damaging Het
Poteg T C 8: 27,448,040 Y75H probably benign Het
Proser1 G C 3: 53,478,556 G620R probably damaging Het
Prpsap1 A T 11: 116,478,613 L164H probably damaging Het
Rfc3 A T 5: 151,644,916 V195E possibly damaging Het
Sarm1 A T 11: 78,487,968 V417D probably damaging Het
She A G 3: 89,831,867 T122A probably benign Het
Srpr A G 9: 35,214,837 E442G probably benign Het
Sult2a6 T A 7: 14,250,432 R124S probably damaging Het
Synm T C 7: 67,733,763 T1384A probably benign Het
Tenm3 A G 8: 48,293,509 V1087A probably damaging Het
Trbv31 C A 6: 41,557,763 D89Y possibly damaging Het
Trpc7 G A 13: 56,822,469 T434I probably benign Het
Tubgcp4 T A 2: 121,194,153 I603N probably benign Het
Ugt3a1 A G 15: 9,310,583 N317S possibly damaging Het
Vdac1 C T 11: 52,376,503 T77I possibly damaging Het
Vmn2r113 A T 17: 22,958,779 R846* probably null Het
Zc3h12d GCCC GCC 10: 7,839,971 probably null Het
Zranb2 G T 3: 157,546,675 R310S unknown Het
Other mutations in Ticam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02160:Ticam1 APN 17 56270560 missense possibly damaging 0.80
IGL02164:Ticam1 APN 17 56270019 missense unknown
Lps2 UTSW 17 56271576 small deletion
Pangu UTSW 17 56276693 critical splice donor site probably benign
Yue UTSW 17 56271339 missense probably benign 0.06
R0930:Ticam1 UTSW 17 56270226 missense unknown
R0930:Ticam1 UTSW 17 56271687 missense probably damaging 1.00
R1509:Ticam1 UTSW 17 56271113 missense probably benign 0.43
R1837:Ticam1 UTSW 17 56270799 missense possibly damaging 0.87
R1863:Ticam1 UTSW 17 56271436 missense probably damaging 1.00
R1867:Ticam1 UTSW 17 56271718 missense probably benign 0.01
R1872:Ticam1 UTSW 17 56271897 missense probably benign 0.00
R1893:Ticam1 UTSW 17 56271894 missense probably benign 0.36
R1980:Ticam1 UTSW 17 56271555 missense probably damaging 0.99
R1981:Ticam1 UTSW 17 56271555 missense probably damaging 0.99
R1982:Ticam1 UTSW 17 56271555 missense probably damaging 0.99
R2263:Ticam1 UTSW 17 56271888 missense possibly damaging 0.95
R2513:Ticam1 UTSW 17 56271612 missense possibly damaging 0.61
R4294:Ticam1 UTSW 17 56271339 missense probably benign 0.06
R4888:Ticam1 UTSW 17 56271642 missense probably damaging 0.98
R4982:Ticam1 UTSW 17 56272020 missense probably benign 0.10
R5396:Ticam1 UTSW 17 56271117 missense probably benign 0.02
R5604:Ticam1 UTSW 17 56271756 missense probably benign 0.13
R5641:Ticam1 UTSW 17 56270629 frame shift probably null
R5647:Ticam1 UTSW 17 56270629 frame shift probably null
R5648:Ticam1 UTSW 17 56270629 frame shift probably null
R5657:Ticam1 UTSW 17 56270629 frame shift probably null
R5770:Ticam1 UTSW 17 56270629 frame shift probably null
R5771:Ticam1 UTSW 17 56270629 frame shift probably null
R5964:Ticam1 UTSW 17 56271703 missense probably damaging 0.99
R5974:Ticam1 UTSW 17 56271178 missense probably benign
R6217:Ticam1 UTSW 17 56270730 missense probably damaging 1.00
R6983:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6984:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6985:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6986:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6987:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6988:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6989:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R7029:Ticam1 UTSW 17 56271154 missense possibly damaging 0.51
R7684:Ticam1 UTSW 17 56269984 missense unknown
R7755:Ticam1 UTSW 17 56270182 missense unknown
R7885:Ticam1 UTSW 17 56271067 missense probably benign 0.04
R8021:Ticam1 UTSW 17 56270089 missense unknown
R8822:Ticam1 UTSW 17 56271444 missense probably damaging 1.00
V8831:Ticam1 UTSW 17 56269969 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CACTTTCTGTGGTGGACGTC -3'
(R):5'- CAGACTGGAGTTGGGGACATAC -3'

Sequencing Primer
(F):5'- TGGACGTCAGGGGAGAC -3'
(R):5'- AGTTGGGGACATACGTTACACTCC -3'
Posted On2020-10-20