Incidental Mutation 'R8415:Mast3'
ID652892
Institutional Source Beutler Lab
Gene Symbol Mast3
Ensembl Gene ENSMUSG00000031833
Gene Namemicrotubule associated serine/threonine kinase 3
Synonyms
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_199308.2. MGI:2683541

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8415 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location70778117-70805054 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70781222 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 960 (Y960H)
Ref Sequence ENSEMBL: ENSMUSP00000148686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034296] [ENSMUST00000166004] [ENSMUST00000211948]
Predicted Effect probably benign
Transcript: ENSMUST00000034296
SMART Domains Protein: ENSMUSP00000034296
Gene: ENSMUSG00000031834

DomainStartEndE-ValueType
SH3 7 79 4e-7 SMART
RhoGAP 122 286 2.36e-18 SMART
low complexity region 291 311 N/A INTRINSIC
SH2 322 405 4.51e-26 SMART
Pfam:PI3K_P85_iSH2 422 590 1.7e-64 PFAM
SH2 614 696 9.96e-28 SMART
low complexity region 713 718 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166004
AA Change: Y976H

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: Y976H

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DUF1908 64 337 4.4e-128 PFAM
S_TKc 373 646 2.77e-99 SMART
S_TK_X 647 710 2.39e-1 SMART
low complexity region 820 833 N/A INTRINSIC
low complexity region 910 942 N/A INTRINSIC
PDZ 958 1038 3.8e-15 SMART
low complexity region 1053 1074 N/A INTRINSIC
low complexity region 1089 1121 N/A INTRINSIC
low complexity region 1124 1150 N/A INTRINSIC
low complexity region 1180 1204 N/A INTRINSIC
low complexity region 1231 1248 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000211948
AA Change: Y960H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd24 A G 10: 81,640,113 H317R unknown Het
Aox1 A T 1: 58,041,479 Y29F probably damaging Het
Bnip2 T C 9: 70,003,685 F304S possibly damaging Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
Ccdc18 T A 5: 108,216,033 V1198E probably damaging Het
Cnot3 T C 7: 3,658,688 F660L probably benign Het
Cntnap3 A G 13: 64,738,665 I1249T probably benign Het
Ctnna3 A G 10: 63,504,130 I32V probably benign Het
D3Ertd254e G A 3: 36,165,033 G402S probably damaging Het
Dgkz A T 2: 91,940,304 S485T possibly damaging Het
Dpagt1 C A 9: 44,327,185 N49K possibly damaging Het
Dsg3 A T 18: 20,523,708 S212C probably damaging Het
Epb41l1 C T 2: 156,526,953 A714V probably benign Het
Eppk1 A G 15: 76,111,631 V350A probably benign Het
Frem1 T G 4: 83,000,262 D481A probably damaging Het
Git2 T C 5: 114,733,928 K532E possibly damaging Het
Glyr1 T C 16: 5,036,465 H102R probably benign Het
Hdgfl2 C T 17: 56,093,712 P160L probably benign Het
Hivep1 T C 13: 42,155,429 S382P probably benign Het
Hmcn2 C A 2: 31,391,076 L1867I probably benign Het
Hydin G A 8: 110,451,994 G1074R probably damaging Het
Ift140 A G 17: 25,092,915 I1271V probably damaging Het
Krt28 T A 11: 99,374,800 I14L probably benign Het
Lrtm2 A T 6: 119,317,497 D224E probably damaging Het
Map1s G A 8: 70,913,266 V272M probably damaging Het
Mettl25 G T 10: 105,826,141 Q323K probably benign Het
Mlh3 A T 12: 85,269,080 S111T probably benign Het
Muc3 A G 5: 137,143,950 L85P Het
Myh6 C G 14: 54,944,378 R1822P probably damaging Het
Myof C T 19: 37,995,424 G144E probably benign Het
Nat8f2 A G 6: 85,868,042 S113P probably damaging Het
Nlrp9a A T 7: 26,557,500 Y181F probably benign Het
Nup85 A G 11: 115,566,642 I57V probably benign Het
Olfr1185-ps1 T A 2: 88,499,366 C94S probably damaging Het
Olfr507 C T 7: 108,621,956 T48I probably damaging Het
Olfr862 T A 9: 19,884,113 Y64F possibly damaging Het
Pcdhb2 A G 18: 37,296,057 N361S probably damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Phf20 C T 2: 156,287,993 T495M probably benign Het
Pih1d3 A G 1: 31,223,483 N182S probably benign Het
Pitpnm1 T C 19: 4,105,454 M368T probably benign Het
Pter A G 2: 13,000,889 D291G probably damaging Het
Rasgrp2 T G 19: 6,404,751 V207G probably damaging Het
Rnd2 A T 11: 101,471,185 Q188L probably benign Het
Sh3d19 T A 3: 86,085,056 D130E probably benign Het
Slc7a2 A T 8: 40,916,359 Y617F probably damaging Het
Snx29 T C 16: 11,447,427 L165P probably damaging Het
St7 T C 6: 17,848,081 probably null Het
Tas2r115 A G 6: 132,737,835 L51P probably damaging Het
Tead1 C A 7: 112,856,928 P164Q probably benign Het
Thop1 A G 10: 81,078,551 Y224C probably damaging Het
Twf1 T C 15: 94,579,821 *351W probably null Het
Uck1 C A 2: 32,260,141 probably benign Het
Utp20 A G 10: 88,826,604 probably null Het
Vmn2r118 G T 17: 55,608,057 L530I probably benign Het
Vmn2r30 A T 7: 7,312,360 C825S probably damaging Het
Vps13d A T 4: 145,091,979 M3106K Het
Wfdc15a A T 2: 164,199,751 C51S probably damaging Het
Zc3hc1 T C 6: 30,375,952 D203G probably damaging Het
Zfhx2 G T 14: 55,070,622 D932E probably benign Het
Other mutations in Mast3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Mast3 APN 8 70780683 splice site probably benign
IGL01411:Mast3 APN 8 70779583 missense possibly damaging 0.50
IGL01475:Mast3 APN 8 70779530 missense probably damaging 1.00
IGL01886:Mast3 APN 8 70782139 missense possibly damaging 0.94
IGL02104:Mast3 APN 8 70787906 missense possibly damaging 0.78
IGL02236:Mast3 APN 8 70789244 missense probably benign 0.36
IGL02437:Mast3 APN 8 70780558 missense possibly damaging 0.79
IGL02704:Mast3 APN 8 70786875 missense probably damaging 1.00
IGL03155:Mast3 APN 8 70789217 missense probably damaging 1.00
IGL03366:Mast3 APN 8 70781563 nonsense probably null
gravy UTSW 8 70786635 missense probably damaging 1.00
stuffing UTSW 8 70784797 frame shift probably null
turkey UTSW 8 70785482 missense probably damaging 1.00
BB010:Mast3 UTSW 8 70786635 missense probably damaging 1.00
BB020:Mast3 UTSW 8 70786635 missense probably damaging 1.00
R0037:Mast3 UTSW 8 70783699 critical splice donor site probably null
R0280:Mast3 UTSW 8 70783795 missense probably damaging 1.00
R0280:Mast3 UTSW 8 70787920 missense possibly damaging 0.65
R0731:Mast3 UTSW 8 70781321 missense probably damaging 1.00
R1101:Mast3 UTSW 8 70786663 missense probably damaging 1.00
R1177:Mast3 UTSW 8 70780324 missense probably damaging 1.00
R1208:Mast3 UTSW 8 70788272 splice site probably null
R1208:Mast3 UTSW 8 70788272 splice site probably null
R1333:Mast3 UTSW 8 70781294 missense probably damaging 1.00
R1543:Mast3 UTSW 8 70792311 missense possibly damaging 0.93
R1544:Mast3 UTSW 8 70786172 missense probably damaging 1.00
R1738:Mast3 UTSW 8 70784556 missense probably benign 0.38
R1842:Mast3 UTSW 8 70780393 missense possibly damaging 0.91
R1936:Mast3 UTSW 8 70784800 missense probably damaging 1.00
R2015:Mast3 UTSW 8 70787363 missense probably benign 0.00
R2219:Mast3 UTSW 8 70780963 missense probably damaging 0.99
R2220:Mast3 UTSW 8 70780963 missense probably damaging 0.99
R3711:Mast3 UTSW 8 70779607 missense probably benign 0.13
R3919:Mast3 UTSW 8 70779422 missense probably benign 0.02
R4027:Mast3 UTSW 8 70787908 missense probably damaging 1.00
R4060:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4061:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4062:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4063:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4588:Mast3 UTSW 8 70780607 nonsense probably null
R4672:Mast3 UTSW 8 70784797 frame shift probably null
R4770:Mast3 UTSW 8 70786220 missense probably damaging 1.00
R4822:Mast3 UTSW 8 70780366 missense probably damaging 1.00
R4830:Mast3 UTSW 8 70788915 missense possibly damaging 0.87
R5196:Mast3 UTSW 8 70788245 missense probably damaging 1.00
R5333:Mast3 UTSW 8 70783501 missense probably benign 0.03
R5428:Mast3 UTSW 8 70784733 missense possibly damaging 0.95
R5656:Mast3 UTSW 8 70786221 missense probably damaging 1.00
R5920:Mast3 UTSW 8 70787933 missense probably benign 0.00
R6177:Mast3 UTSW 8 70790018 missense probably damaging 1.00
R6186:Mast3 UTSW 8 70785483 missense probably damaging 1.00
R6407:Mast3 UTSW 8 70782128 missense probably benign 0.02
R6614:Mast3 UTSW 8 70781966 missense possibly damaging 0.95
R6804:Mast3 UTSW 8 70786732 missense probably benign 0.29
R6873:Mast3 UTSW 8 70786592 nonsense probably null
R6930:Mast3 UTSW 8 70799471 nonsense probably null
R6948:Mast3 UTSW 8 70785482 missense probably damaging 1.00
R7084:Mast3 UTSW 8 70779473 missense probably benign 0.14
R7253:Mast3 UTSW 8 70789682 critical splice donor site probably null
R7316:Mast3 UTSW 8 70779788 missense probably damaging 1.00
R7357:Mast3 UTSW 8 70784859 missense probably damaging 1.00
R7405:Mast3 UTSW 8 70786171 missense probably damaging 1.00
R7429:Mast3 UTSW 8 70780303 missense probably damaging 1.00
R7430:Mast3 UTSW 8 70780303 missense probably damaging 1.00
R7521:Mast3 UTSW 8 70788768 missense probably benign 0.16
R7576:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R7933:Mast3 UTSW 8 70786635 missense probably damaging 1.00
R7998:Mast3 UTSW 8 70783570 missense probably benign
R8021:Mast3 UTSW 8 70788252 missense probably benign 0.02
R8204:Mast3 UTSW 8 70788281 missense probably benign 0.00
R8327:Mast3 UTSW 8 70779418 missense probably damaging 1.00
R8357:Mast3 UTSW 8 70780441 missense probably benign 0.39
R8457:Mast3 UTSW 8 70780441 missense probably benign 0.39
R8530:Mast3 UTSW 8 70788233 missense possibly damaging 0.92
R8891:Mast3 UTSW 8 70781157 missense probably damaging 1.00
R9002:Mast3 UTSW 8 70781260 missense probably damaging 1.00
Z1177:Mast3 UTSW 8 70789038 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TCAGGTATAGCAGGCCACAC -3'
(R):5'- TTCTAGAACTGGACACAAGGC -3'

Sequencing Primer
(F):5'- CCCCCACAAGCCCATGG -3'
(R):5'- AACCCACATGTAATGAGTGTTCTTCC -3'
Posted On2020-10-20