Incidental Mutation 'R8415:Mast3'
ID 652892
Institutional Source Beutler Lab
Gene Symbol Mast3
Ensembl Gene ENSMUSG00000031833
Gene Name microtubule associated serine/threonine kinase 3
Synonyms
MMRRC Submission 067769-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8415 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 71230761-71257681 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 71233866 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 960 (Y960H)
Ref Sequence ENSEMBL: ENSMUSP00000148686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034296] [ENSMUST00000166004] [ENSMUST00000211948]
AlphaFold Q3U214
Predicted Effect probably benign
Transcript: ENSMUST00000034296
SMART Domains Protein: ENSMUSP00000034296
Gene: ENSMUSG00000031834

DomainStartEndE-ValueType
SH3 7 79 4e-7 SMART
RhoGAP 122 286 2.36e-18 SMART
low complexity region 291 311 N/A INTRINSIC
SH2 322 405 4.51e-26 SMART
Pfam:PI3K_P85_iSH2 422 590 1.7e-64 PFAM
SH2 614 696 9.96e-28 SMART
low complexity region 713 718 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166004
AA Change: Y976H

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: Y976H

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DUF1908 64 337 4.4e-128 PFAM
S_TKc 373 646 2.77e-99 SMART
S_TK_X 647 710 2.39e-1 SMART
low complexity region 820 833 N/A INTRINSIC
low complexity region 910 942 N/A INTRINSIC
PDZ 958 1038 3.8e-15 SMART
low complexity region 1053 1074 N/A INTRINSIC
low complexity region 1089 1121 N/A INTRINSIC
low complexity region 1124 1150 N/A INTRINSIC
low complexity region 1180 1204 N/A INTRINSIC
low complexity region 1231 1248 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000211948
AA Change: Y960H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd24 A G 10: 81,475,947 (GRCm39) H317R unknown Het
Aox1 A T 1: 58,080,638 (GRCm39) Y29F probably damaging Het
Bnip2 T C 9: 69,910,967 (GRCm39) F304S possibly damaging Het
Bsn G A 9: 107,988,651 (GRCm39) A2367V probably benign Het
Ccdc18 T A 5: 108,363,899 (GRCm39) V1198E probably damaging Het
Cnot3 T C 7: 3,661,687 (GRCm39) F660L probably benign Het
Cntnap3 A G 13: 64,886,479 (GRCm39) I1249T probably benign Het
Ctnna3 A G 10: 63,339,909 (GRCm39) I32V probably benign Het
Dgkz A T 2: 91,770,649 (GRCm39) S485T possibly damaging Het
Dnaaf6rt A G 1: 31,262,564 (GRCm39) N182S probably benign Het
Dpagt1 C A 9: 44,238,482 (GRCm39) N49K possibly damaging Het
Dsg3 A T 18: 20,656,765 (GRCm39) S212C probably damaging Het
Epb41l1 C T 2: 156,368,873 (GRCm39) A714V probably benign Het
Eppk1 A G 15: 75,995,831 (GRCm39) V350A probably benign Het
Frem1 T G 4: 82,918,499 (GRCm39) D481A probably damaging Het
Git2 T C 5: 114,871,989 (GRCm39) K532E possibly damaging Het
Glyr1 T C 16: 4,854,329 (GRCm39) H102R probably benign Het
Hdgfl2 C T 17: 56,400,712 (GRCm39) P160L probably benign Het
Hivep1 T C 13: 42,308,905 (GRCm39) S382P probably benign Het
Hmcn2 C A 2: 31,281,088 (GRCm39) L1867I probably benign Het
Hydin G A 8: 111,178,626 (GRCm39) G1074R probably damaging Het
Ift140 A G 17: 25,311,889 (GRCm39) I1271V probably damaging Het
Krt28 T A 11: 99,265,626 (GRCm39) I14L probably benign Het
Lrtm2 A T 6: 119,294,458 (GRCm39) D224E probably damaging Het
Map1s G A 8: 71,365,910 (GRCm39) V272M probably damaging Het
Mettl25 G T 10: 105,662,002 (GRCm39) Q323K probably benign Het
Mlh3 A T 12: 85,315,854 (GRCm39) S111T probably benign Het
Muc17 A G 5: 137,172,798 (GRCm39) L85P Het
Myh6 C G 14: 55,181,835 (GRCm39) R1822P probably damaging Het
Myof C T 19: 37,983,872 (GRCm39) G144E probably benign Het
Nat8f2 A G 6: 85,845,024 (GRCm39) S113P probably damaging Het
Nlrp9a A T 7: 26,256,925 (GRCm39) Y181F probably benign Het
Nup85 A G 11: 115,457,468 (GRCm39) I57V probably benign Het
Or4c99 T A 2: 88,329,710 (GRCm39) C94S probably damaging Het
Or5p79 C T 7: 108,221,163 (GRCm39) T48I probably damaging Het
Or7e170 T A 9: 19,795,409 (GRCm39) Y64F possibly damaging Het
Pcdhb2 A G 18: 37,429,110 (GRCm39) N361S probably damaging Het
Peg10 T TCCA 6: 4,756,451 (GRCm39) probably benign Het
Phf20 C T 2: 156,129,913 (GRCm39) T495M probably benign Het
Pitpnm1 T C 19: 4,155,454 (GRCm39) M368T probably benign Het
Pter A G 2: 13,005,700 (GRCm39) D291G probably damaging Het
Rasgrp2 T G 19: 6,454,781 (GRCm39) V207G probably damaging Het
Rnd2 A T 11: 101,362,011 (GRCm39) Q188L probably benign Het
Sh3d19 T A 3: 85,992,363 (GRCm39) D130E probably benign Het
Slc7a2 A T 8: 41,369,396 (GRCm39) Y617F probably damaging Het
Snx29 T C 16: 11,265,291 (GRCm39) L165P probably damaging Het
St7 T C 6: 17,848,080 (GRCm39) probably null Het
Tas2r115 A G 6: 132,714,798 (GRCm39) L51P probably damaging Het
Tead1 C A 7: 112,456,135 (GRCm39) P164Q probably benign Het
Thop1 A G 10: 80,914,385 (GRCm39) Y224C probably damaging Het
Twf1 T C 15: 94,477,702 (GRCm39) *351W probably null Het
Uck1 C A 2: 32,150,153 (GRCm39) probably benign Het
Utp20 A G 10: 88,662,466 (GRCm39) probably null Het
Vmn2r118 G T 17: 55,915,057 (GRCm39) L530I probably benign Het
Vmn2r30 A T 7: 7,315,359 (GRCm39) C825S probably damaging Het
Vps13d A T 4: 144,818,549 (GRCm39) M3106K Het
Wfdc15a A T 2: 164,041,671 (GRCm39) C51S probably damaging Het
Zc3hc1 T C 6: 30,375,951 (GRCm39) D203G probably damaging Het
Zfhx2 G T 14: 55,308,079 (GRCm39) D932E probably benign Het
Zfp267 G A 3: 36,219,182 (GRCm39) G402S probably damaging Het
Other mutations in Mast3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Mast3 APN 8 71,233,327 (GRCm39) splice site probably benign
IGL01411:Mast3 APN 8 71,232,227 (GRCm39) missense possibly damaging 0.50
IGL01475:Mast3 APN 8 71,232,174 (GRCm39) missense probably damaging 1.00
IGL01886:Mast3 APN 8 71,234,783 (GRCm39) missense possibly damaging 0.94
IGL02104:Mast3 APN 8 71,240,550 (GRCm39) missense possibly damaging 0.78
IGL02236:Mast3 APN 8 71,241,888 (GRCm39) missense probably benign 0.36
IGL02437:Mast3 APN 8 71,233,202 (GRCm39) missense possibly damaging 0.79
IGL02704:Mast3 APN 8 71,239,519 (GRCm39) missense probably damaging 1.00
IGL03155:Mast3 APN 8 71,241,861 (GRCm39) missense probably damaging 1.00
IGL03366:Mast3 APN 8 71,234,207 (GRCm39) nonsense probably null
gravy UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
stuffing UTSW 8 71,237,441 (GRCm39) frame shift probably null
turkey UTSW 8 71,238,126 (GRCm39) missense probably damaging 1.00
BB010:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
BB020:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
R0037:Mast3 UTSW 8 71,236,343 (GRCm39) critical splice donor site probably null
R0280:Mast3 UTSW 8 71,240,564 (GRCm39) missense possibly damaging 0.65
R0280:Mast3 UTSW 8 71,236,439 (GRCm39) missense probably damaging 1.00
R0731:Mast3 UTSW 8 71,233,965 (GRCm39) missense probably damaging 1.00
R1101:Mast3 UTSW 8 71,239,307 (GRCm39) missense probably damaging 1.00
R1177:Mast3 UTSW 8 71,232,968 (GRCm39) missense probably damaging 1.00
R1208:Mast3 UTSW 8 71,240,916 (GRCm39) splice site probably null
R1208:Mast3 UTSW 8 71,240,916 (GRCm39) splice site probably null
R1333:Mast3 UTSW 8 71,233,938 (GRCm39) missense probably damaging 1.00
R1543:Mast3 UTSW 8 71,244,955 (GRCm39) missense possibly damaging 0.93
R1544:Mast3 UTSW 8 71,238,816 (GRCm39) missense probably damaging 1.00
R1738:Mast3 UTSW 8 71,237,200 (GRCm39) missense probably benign 0.38
R1842:Mast3 UTSW 8 71,233,037 (GRCm39) missense possibly damaging 0.91
R1936:Mast3 UTSW 8 71,237,444 (GRCm39) missense probably damaging 1.00
R2015:Mast3 UTSW 8 71,240,007 (GRCm39) missense probably benign 0.00
R2219:Mast3 UTSW 8 71,233,607 (GRCm39) missense probably damaging 0.99
R2220:Mast3 UTSW 8 71,233,607 (GRCm39) missense probably damaging 0.99
R3711:Mast3 UTSW 8 71,232,251 (GRCm39) missense probably benign 0.13
R3919:Mast3 UTSW 8 71,232,066 (GRCm39) missense probably benign 0.02
R4027:Mast3 UTSW 8 71,240,552 (GRCm39) missense probably damaging 1.00
R4060:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4061:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4062:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4063:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4588:Mast3 UTSW 8 71,233,251 (GRCm39) nonsense probably null
R4672:Mast3 UTSW 8 71,237,441 (GRCm39) frame shift probably null
R4770:Mast3 UTSW 8 71,238,864 (GRCm39) missense probably damaging 1.00
R4822:Mast3 UTSW 8 71,233,010 (GRCm39) missense probably damaging 1.00
R4830:Mast3 UTSW 8 71,241,559 (GRCm39) missense possibly damaging 0.87
R5196:Mast3 UTSW 8 71,240,889 (GRCm39) missense probably damaging 1.00
R5333:Mast3 UTSW 8 71,236,145 (GRCm39) missense probably benign 0.03
R5428:Mast3 UTSW 8 71,237,377 (GRCm39) missense possibly damaging 0.95
R5656:Mast3 UTSW 8 71,238,865 (GRCm39) missense probably damaging 1.00
R5920:Mast3 UTSW 8 71,240,577 (GRCm39) missense probably benign 0.00
R6177:Mast3 UTSW 8 71,242,662 (GRCm39) missense probably damaging 1.00
R6186:Mast3 UTSW 8 71,238,127 (GRCm39) missense probably damaging 1.00
R6407:Mast3 UTSW 8 71,234,772 (GRCm39) missense probably benign 0.02
R6614:Mast3 UTSW 8 71,234,610 (GRCm39) missense possibly damaging 0.95
R6804:Mast3 UTSW 8 71,239,376 (GRCm39) missense probably benign 0.29
R6873:Mast3 UTSW 8 71,239,236 (GRCm39) nonsense probably null
R6930:Mast3 UTSW 8 71,252,115 (GRCm39) nonsense probably null
R6948:Mast3 UTSW 8 71,238,126 (GRCm39) missense probably damaging 1.00
R7084:Mast3 UTSW 8 71,232,117 (GRCm39) missense probably benign 0.14
R7253:Mast3 UTSW 8 71,242,326 (GRCm39) critical splice donor site probably null
R7316:Mast3 UTSW 8 71,232,432 (GRCm39) missense probably damaging 1.00
R7357:Mast3 UTSW 8 71,237,503 (GRCm39) missense probably damaging 1.00
R7405:Mast3 UTSW 8 71,238,815 (GRCm39) missense probably damaging 1.00
R7429:Mast3 UTSW 8 71,232,947 (GRCm39) missense probably damaging 1.00
R7430:Mast3 UTSW 8 71,232,947 (GRCm39) missense probably damaging 1.00
R7521:Mast3 UTSW 8 71,241,412 (GRCm39) missense probably benign 0.16
R7576:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R7933:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
R7998:Mast3 UTSW 8 71,236,214 (GRCm39) missense probably benign
R8021:Mast3 UTSW 8 71,240,896 (GRCm39) missense probably benign 0.02
R8204:Mast3 UTSW 8 71,240,925 (GRCm39) missense probably benign 0.00
R8327:Mast3 UTSW 8 71,232,062 (GRCm39) missense probably damaging 1.00
R8357:Mast3 UTSW 8 71,233,085 (GRCm39) missense probably benign 0.39
R8457:Mast3 UTSW 8 71,233,085 (GRCm39) missense probably benign 0.39
R8530:Mast3 UTSW 8 71,240,877 (GRCm39) missense possibly damaging 0.92
R8891:Mast3 UTSW 8 71,233,801 (GRCm39) missense probably damaging 1.00
R8930:Mast3 UTSW 8 71,234,377 (GRCm39) splice site probably benign
R9002:Mast3 UTSW 8 71,233,904 (GRCm39) missense probably damaging 1.00
R9085:Mast3 UTSW 8 71,249,361 (GRCm39) missense unknown
R9087:Mast3 UTSW 8 71,242,330 (GRCm39) missense possibly damaging 0.93
R9148:Mast3 UTSW 8 71,233,091 (GRCm39) missense probably damaging 0.98
R9364:Mast3 UTSW 8 71,238,826 (GRCm39) missense probably damaging 1.00
R9779:Mast3 UTSW 8 71,238,127 (GRCm39) missense probably damaging 1.00
Z1177:Mast3 UTSW 8 71,241,682 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TCAGGTATAGCAGGCCACAC -3'
(R):5'- TTCTAGAACTGGACACAAGGC -3'

Sequencing Primer
(F):5'- CCCCCACAAGCCCATGG -3'
(R):5'- AACCCACATGTAATGAGTGTTCTTCC -3'
Posted On 2020-10-20