Incidental Mutation 'R8415:Utp20'
ID652902
Institutional Source Beutler Lab
Gene Symbol Utp20
Ensembl Gene ENSMUSG00000004356
Gene NameUTP20 small subunit processome component
Synonyms3830408P06Rik, DRIM, mDRIM
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R8415 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location88746607-88826804 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 88826604 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000004470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004470]
Predicted Effect probably null
Transcript: ENSMUST00000004470
SMART Domains Protein: ENSMUSP00000004470
Gene: ENSMUSG00000004356

DomainStartEndE-ValueType
low complexity region 244 255 N/A INTRINSIC
low complexity region 442 454 N/A INTRINSIC
low complexity region 571 581 N/A INTRINSIC
low complexity region 695 704 N/A INTRINSIC
Pfam:DRIM 910 1534 2.6e-176 PFAM
low complexity region 1585 1598 N/A INTRINSIC
low complexity region 1705 1719 N/A INTRINSIC
low complexity region 2503 2513 N/A INTRINSIC
low complexity region 2589 2605 N/A INTRINSIC
low complexity region 2727 2737 N/A INTRINSIC
low complexity region 2746 2764 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UTP20 is a component of the U3 small nucleolar RNA (snoRNA) (SNORD3A; MIM 180710) protein complex (U3 snoRNP) and is involved in 18S rRNA processing (Wang et al., 2007 [PubMed 17498821]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd24 A G 10: 81,640,113 H317R unknown Het
Aox1 A T 1: 58,041,479 Y29F probably damaging Het
Bnip2 T C 9: 70,003,685 F304S possibly damaging Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
Ccdc18 T A 5: 108,216,033 V1198E probably damaging Het
Cnot3 T C 7: 3,658,688 F660L probably benign Het
Cntnap3 A G 13: 64,738,665 I1249T probably benign Het
Ctnna3 A G 10: 63,504,130 I32V probably benign Het
D3Ertd254e G A 3: 36,165,033 G402S probably damaging Het
Dgkz A T 2: 91,940,304 S485T possibly damaging Het
Dpagt1 C A 9: 44,327,185 N49K possibly damaging Het
Dsg3 A T 18: 20,523,708 S212C probably damaging Het
Epb41l1 C T 2: 156,526,953 A714V probably benign Het
Eppk1 A G 15: 76,111,631 V350A probably benign Het
Frem1 T G 4: 83,000,262 D481A probably damaging Het
Git2 T C 5: 114,733,928 K532E possibly damaging Het
Glyr1 T C 16: 5,036,465 H102R probably benign Het
Hdgfl2 C T 17: 56,093,712 P160L probably benign Het
Hivep1 T C 13: 42,155,429 S382P probably benign Het
Hmcn2 C A 2: 31,391,076 L1867I probably benign Het
Hydin G A 8: 110,451,994 G1074R probably damaging Het
Ift140 A G 17: 25,092,915 I1271V probably damaging Het
Krt28 T A 11: 99,374,800 I14L probably benign Het
Lrtm2 A T 6: 119,317,497 D224E probably damaging Het
Map1s G A 8: 70,913,266 V272M probably damaging Het
Mast3 A G 8: 70,781,222 Y960H probably damaging Het
Mettl25 G T 10: 105,826,141 Q323K probably benign Het
Mlh3 A T 12: 85,269,080 S111T probably benign Het
Muc3 A G 5: 137,143,950 L85P Het
Myh6 C G 14: 54,944,378 R1822P probably damaging Het
Myof C T 19: 37,995,424 G144E probably benign Het
Nat8f2 A G 6: 85,868,042 S113P probably damaging Het
Nlrp9a A T 7: 26,557,500 Y181F probably benign Het
Nup85 A G 11: 115,566,642 I57V probably benign Het
Olfr1185-ps1 T A 2: 88,499,366 C94S probably damaging Het
Olfr507 C T 7: 108,621,956 T48I probably damaging Het
Olfr862 T A 9: 19,884,113 Y64F possibly damaging Het
Pcdhb2 A G 18: 37,296,057 N361S probably damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Phf20 C T 2: 156,287,993 T495M probably benign Het
Pih1d3 A G 1: 31,223,483 N182S probably benign Het
Pitpnm1 T C 19: 4,105,454 M368T probably benign Het
Pter A G 2: 13,000,889 D291G probably damaging Het
Rasgrp2 T G 19: 6,404,751 V207G probably damaging Het
Rnd2 A T 11: 101,471,185 Q188L probably benign Het
Sh3d19 T A 3: 86,085,056 D130E probably benign Het
Slc7a2 A T 8: 40,916,359 Y617F probably damaging Het
Snx29 T C 16: 11,447,427 L165P probably damaging Het
St7 T C 6: 17,848,081 probably null Het
Tas2r115 A G 6: 132,737,835 L51P probably damaging Het
Tead1 C A 7: 112,856,928 P164Q probably benign Het
Thop1 A G 10: 81,078,551 Y224C probably damaging Het
Twf1 T C 15: 94,579,821 *351W probably null Het
Uck1 C A 2: 32,260,141 probably benign Het
Vmn2r118 G T 17: 55,608,057 L530I probably benign Het
Vmn2r30 A T 7: 7,312,360 C825S probably damaging Het
Vps13d A T 4: 145,091,979 M3106K Het
Wfdc15a A T 2: 164,199,751 C51S probably damaging Het
Zc3hc1 T C 6: 30,375,952 D203G probably damaging Het
Zfhx2 G T 14: 55,070,622 D932E probably benign Het
Other mutations in Utp20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Utp20 APN 10 88825444 missense possibly damaging 0.90
IGL00858:Utp20 APN 10 88809125 missense possibly damaging 0.69
IGL00858:Utp20 APN 10 88809138 missense probably benign
IGL00946:Utp20 APN 10 88748315 missense possibly damaging 0.82
IGL01061:Utp20 APN 10 88770704 missense probably benign 0.13
IGL01399:Utp20 APN 10 88758302 critical splice donor site probably null
IGL01548:Utp20 APN 10 88764781 missense probably damaging 1.00
IGL01587:Utp20 APN 10 88787535 missense probably damaging 0.98
IGL01789:Utp20 APN 10 88798279 critical splice donor site probably null
IGL01819:Utp20 APN 10 88792687 missense probably damaging 1.00
IGL02070:Utp20 APN 10 88821877 splice site probably benign
IGL02231:Utp20 APN 10 88791168 missense probably damaging 1.00
IGL02244:Utp20 APN 10 88815956 splice site probably benign
IGL02367:Utp20 APN 10 88771853 unclassified probably benign
IGL02553:Utp20 APN 10 88764795 missense probably damaging 0.99
IGL02748:Utp20 APN 10 88817295 missense probably benign 0.00
IGL02831:Utp20 APN 10 88815908 missense probably benign
IGL02986:Utp20 APN 10 88775285 missense probably damaging 1.00
IGL02997:Utp20 APN 10 88814034 missense probably benign
IGL03105:Utp20 APN 10 88791096 missense probably benign 0.10
IGL03251:Utp20 APN 10 88817326 critical splice acceptor site probably null
IGL03337:Utp20 APN 10 88754566 missense probably benign
IGL03348:Utp20 APN 10 88758317 missense probably benign 0.09
IGL03381:Utp20 APN 10 88822005 missense probably damaging 0.99
R0037:Utp20 UTSW 10 88798404 missense probably benign 0.05
R0107:Utp20 UTSW 10 88778391 missense probably benign 0.03
R0197:Utp20 UTSW 10 88777516 missense probably benign 0.22
R0219:Utp20 UTSW 10 88764675 missense probably damaging 1.00
R0315:Utp20 UTSW 10 88807421 missense probably damaging 1.00
R0328:Utp20 UTSW 10 88767107 missense possibly damaging 0.82
R0329:Utp20 UTSW 10 88817979 missense probably benign 0.00
R0330:Utp20 UTSW 10 88817979 missense probably benign 0.00
R0395:Utp20 UTSW 10 88818595 missense probably damaging 1.00
R0399:Utp20 UTSW 10 88820979 missense probably damaging 1.00
R0454:Utp20 UTSW 10 88822069 missense probably benign 0.00
R0456:Utp20 UTSW 10 88754573 missense possibly damaging 0.92
R0491:Utp20 UTSW 10 88760912 missense probably damaging 1.00
R0557:Utp20 UTSW 10 88748311 missense probably damaging 0.99
R0600:Utp20 UTSW 10 88767461 missense probably damaging 1.00
R0616:Utp20 UTSW 10 88770751 missense probably benign 0.14
R1076:Utp20 UTSW 10 88772459 missense probably benign 0.36
R1076:Utp20 UTSW 10 88772543 missense possibly damaging 0.86
R1330:Utp20 UTSW 10 88801189 missense probably damaging 0.96
R1440:Utp20 UTSW 10 88819339 missense probably benign 0.19
R1529:Utp20 UTSW 10 88753006 missense probably damaging 1.00
R1554:Utp20 UTSW 10 88764737 nonsense probably null
R1621:Utp20 UTSW 10 88762871 missense probably benign
R1641:Utp20 UTSW 10 88757972 missense possibly damaging 0.82
R1709:Utp20 UTSW 10 88749297 missense probably benign 0.29
R1734:Utp20 UTSW 10 88767461 missense probably damaging 1.00
R1755:Utp20 UTSW 10 88809769 missense probably benign 0.01
R1775:Utp20 UTSW 10 88770808 missense probably benign
R1866:Utp20 UTSW 10 88762770 nonsense probably null
R1867:Utp20 UTSW 10 88749443 missense probably benign
R1901:Utp20 UTSW 10 88753026 missense probably benign 0.02
R1902:Utp20 UTSW 10 88753026 missense probably benign 0.02
R1967:Utp20 UTSW 10 88816979 missense probably benign 0.03
R2060:Utp20 UTSW 10 88774795 missense probably damaging 0.98
R2102:Utp20 UTSW 10 88772917 missense probably damaging 0.99
R2110:Utp20 UTSW 10 88767451 critical splice donor site probably null
R2115:Utp20 UTSW 10 88786003 missense probably benign 0.02
R2128:Utp20 UTSW 10 88814055 missense probably damaging 0.99
R2129:Utp20 UTSW 10 88814055 missense probably damaging 0.99
R2180:Utp20 UTSW 10 88820939 missense probably damaging 0.98
R2280:Utp20 UTSW 10 88825503 splice site probably null
R2435:Utp20 UTSW 10 88820891 missense possibly damaging 0.89
R2914:Utp20 UTSW 10 88754475 critical splice donor site probably null
R3005:Utp20 UTSW 10 88777455 missense probably damaging 0.97
R3546:Utp20 UTSW 10 88782689 missense probably damaging 1.00
R3547:Utp20 UTSW 10 88782689 missense probably damaging 1.00
R3622:Utp20 UTSW 10 88757993 unclassified probably benign
R3737:Utp20 UTSW 10 88762806 missense probably benign 0.00
R3738:Utp20 UTSW 10 88762806 missense probably benign 0.00
R3841:Utp20 UTSW 10 88775203 unclassified probably benign
R4034:Utp20 UTSW 10 88762806 missense probably benign 0.00
R4035:Utp20 UTSW 10 88762806 missense probably benign 0.00
R4157:Utp20 UTSW 10 88761867 missense probably benign
R4243:Utp20 UTSW 10 88807325 critical splice donor site probably null
R4295:Utp20 UTSW 10 88754519 missense possibly damaging 0.54
R4632:Utp20 UTSW 10 88778261 missense probably damaging 1.00
R4633:Utp20 UTSW 10 88752952 missense probably benign
R4684:Utp20 UTSW 10 88807445 nonsense probably null
R4731:Utp20 UTSW 10 88754520 missense possibly damaging 0.93
R4735:Utp20 UTSW 10 88816918 missense possibly damaging 0.91
R4772:Utp20 UTSW 10 88809935 missense probably benign 0.09
R4912:Utp20 UTSW 10 88771960 missense probably benign 0.01
R4974:Utp20 UTSW 10 88816949 missense probably benign 0.08
R4991:Utp20 UTSW 10 88746934 missense probably benign 0.09
R5004:Utp20 UTSW 10 88748273 missense probably damaging 0.98
R5037:Utp20 UTSW 10 88775330 missense probably benign 0.00
R5043:Utp20 UTSW 10 88798746 missense possibly damaging 0.70
R5108:Utp20 UTSW 10 88768873 missense probably benign 0.00
R5138:Utp20 UTSW 10 88747377 missense probably damaging 0.96
R5252:Utp20 UTSW 10 88750670 missense probably benign 0.01
R5394:Utp20 UTSW 10 88772915 nonsense probably null
R5470:Utp20 UTSW 10 88817896 missense probably benign 0.14
R5558:Utp20 UTSW 10 88751467 missense probably damaging 1.00
R5678:Utp20 UTSW 10 88809117 missense probably benign 0.00
R5822:Utp20 UTSW 10 88817285 missense probably benign 0.00
R5866:Utp20 UTSW 10 88772559 missense possibly damaging 0.82
R5924:Utp20 UTSW 10 88815922 missense probably benign 0.00
R6026:Utp20 UTSW 10 88768679 missense probably benign 0.04
R6363:Utp20 UTSW 10 88757080 missense probably damaging 1.00
R6434:Utp20 UTSW 10 88772533 nonsense probably null
R6477:Utp20 UTSW 10 88768918 missense probably benign 0.05
R6480:Utp20 UTSW 10 88755186 critical splice donor site probably null
R6989:Utp20 UTSW 10 88778240 missense probably benign 0.00
R7033:Utp20 UTSW 10 88754475 critical splice donor site probably null
R7192:Utp20 UTSW 10 88772459 missense probably benign 0.09
R7236:Utp20 UTSW 10 88749342 missense probably benign 0.28
R7260:Utp20 UTSW 10 88751472 missense probably benign 0.39
R7296:Utp20 UTSW 10 88770724 missense probably benign 0.21
R7317:Utp20 UTSW 10 88762935 missense possibly damaging 0.83
R7318:Utp20 UTSW 10 88813949 missense possibly damaging 0.89
R7330:Utp20 UTSW 10 88787562 frame shift probably null
R7367:Utp20 UTSW 10 88795443 missense probably benign 0.21
R7432:Utp20 UTSW 10 88798398 missense probably benign 0.00
R7447:Utp20 UTSW 10 88772492 missense probably damaging 1.00
R7473:Utp20 UTSW 10 88820710 splice site probably null
R7520:Utp20 UTSW 10 88818595 missense probably damaging 1.00
R7530:Utp20 UTSW 10 88753006 missense probably damaging 1.00
R7539:Utp20 UTSW 10 88791745 missense probably damaging 1.00
R7651:Utp20 UTSW 10 88754595 missense probably benign 0.41
R7728:Utp20 UTSW 10 88798341 missense probably damaging 1.00
R7831:Utp20 UTSW 10 88762770 nonsense probably null
R7833:Utp20 UTSW 10 88801136 missense possibly damaging 0.92
R7909:Utp20 UTSW 10 88775330 missense probably benign
R7956:Utp20 UTSW 10 88782614 missense probably benign 0.23
R7999:Utp20 UTSW 10 88770388 missense probably benign
R8080:Utp20 UTSW 10 88782715 missense possibly damaging 0.82
R8098:Utp20 UTSW 10 88752948 missense probably benign 0.13
R8104:Utp20 UTSW 10 88757904 missense probably damaging 1.00
R8129:Utp20 UTSW 10 88792625 missense probably benign 0.29
R8147:Utp20 UTSW 10 88758444 missense probably benign 0.02
R8199:Utp20 UTSW 10 88798475 missense probably benign
R8222:Utp20 UTSW 10 88778372 missense probably damaging 1.00
R8466:Utp20 UTSW 10 88818503 missense probably damaging 1.00
R8505:Utp20 UTSW 10 88818008 missense probably benign 0.03
R8802:Utp20 UTSW 10 88747295 missense probably damaging 1.00
R8923:Utp20 UTSW 10 88791742 nonsense probably null
R8945:Utp20 UTSW 10 88792670 nonsense probably null
RF005:Utp20 UTSW 10 88825457 missense probably damaging 1.00
RF024:Utp20 UTSW 10 88825457 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCACTCCCCTGCGAACTAATG -3'
(R):5'- ACATCCTGGCTTTCCAACATGG -3'

Sequencing Primer
(F):5'- ATACTGGCATAGTCTCCC -3'
(R):5'- CGGCACTAACTACACGTGAGG -3'
Posted On2020-10-20