Incidental Mutation 'R8415:Cntnap3'
ID652909
Institutional Source Beutler Lab
Gene Symbol Cntnap3
Ensembl Gene ENSMUSG00000033063
Gene Namecontactin associated protein-like 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R8415 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location64736182-64903955 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64738665 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 1249 (I1249T)
Ref Sequence ENSEMBL: ENSMUSP00000089140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091554]
Predicted Effect probably benign
Transcript: ENSMUST00000091554
AA Change: I1249T

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: I1249T

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FA58C 33 180 4.88e-17 SMART
LamG 207 345 1.47e-11 SMART
LamG 394 525 1.43e-23 SMART
EGF 553 587 1.33e-1 SMART
FBG 590 775 6.76e-1 SMART
LamG 815 942 1.89e-32 SMART
EGF_like 963 999 6.28e1 SMART
LamG 1040 1178 9.46e-15 SMART
transmembrane domain 1245 1267 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd24 A G 10: 81,640,113 H317R unknown Het
Aox1 A T 1: 58,041,479 Y29F probably damaging Het
Bnip2 T C 9: 70,003,685 F304S possibly damaging Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
Ccdc18 T A 5: 108,216,033 V1198E probably damaging Het
Cnot3 T C 7: 3,658,688 F660L probably benign Het
Ctnna3 A G 10: 63,504,130 I32V probably benign Het
D3Ertd254e G A 3: 36,165,033 G402S probably damaging Het
Dgkz A T 2: 91,940,304 S485T possibly damaging Het
Dpagt1 C A 9: 44,327,185 N49K possibly damaging Het
Dsg3 A T 18: 20,523,708 S212C probably damaging Het
Epb41l1 C T 2: 156,526,953 A714V probably benign Het
Eppk1 A G 15: 76,111,631 V350A probably benign Het
Frem1 T G 4: 83,000,262 D481A probably damaging Het
Git2 T C 5: 114,733,928 K532E possibly damaging Het
Glyr1 T C 16: 5,036,465 H102R probably benign Het
Hdgfl2 C T 17: 56,093,712 P160L probably benign Het
Hivep1 T C 13: 42,155,429 S382P probably benign Het
Hmcn2 C A 2: 31,391,076 L1867I probably benign Het
Hydin G A 8: 110,451,994 G1074R probably damaging Het
Ift140 A G 17: 25,092,915 I1271V probably damaging Het
Krt28 T A 11: 99,374,800 I14L probably benign Het
Lrtm2 A T 6: 119,317,497 D224E probably damaging Het
Map1s G A 8: 70,913,266 V272M probably damaging Het
Mast3 A G 8: 70,781,222 Y960H probably damaging Het
Mettl25 G T 10: 105,826,141 Q323K probably benign Het
Mlh3 A T 12: 85,269,080 S111T probably benign Het
Muc3 A G 5: 137,143,950 L85P Het
Myh6 C G 14: 54,944,378 R1822P probably damaging Het
Myof C T 19: 37,995,424 G144E probably benign Het
Nat8f2 A G 6: 85,868,042 S113P probably damaging Het
Nlrp9a A T 7: 26,557,500 Y181F probably benign Het
Nup85 A G 11: 115,566,642 I57V probably benign Het
Olfr1185-ps1 T A 2: 88,499,366 C94S probably damaging Het
Olfr507 C T 7: 108,621,956 T48I probably damaging Het
Olfr862 T A 9: 19,884,113 Y64F possibly damaging Het
Pcdhb2 A G 18: 37,296,057 N361S probably damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Phf20 C T 2: 156,287,993 T495M probably benign Het
Pih1d3 A G 1: 31,223,483 N182S probably benign Het
Pitpnm1 T C 19: 4,105,454 M368T probably benign Het
Pter A G 2: 13,000,889 D291G probably damaging Het
Rasgrp2 T G 19: 6,404,751 V207G probably damaging Het
Rnd2 A T 11: 101,471,185 Q188L probably benign Het
Sh3d19 T A 3: 86,085,056 D130E probably benign Het
Slc7a2 A T 8: 40,916,359 Y617F probably damaging Het
Snx29 T C 16: 11,447,427 L165P probably damaging Het
St7 T C 6: 17,848,081 probably null Het
Tas2r115 A G 6: 132,737,835 L51P probably damaging Het
Tead1 C A 7: 112,856,928 P164Q probably benign Het
Thop1 A G 10: 81,078,551 Y224C probably damaging Het
Twf1 T C 15: 94,579,821 *351W probably null Het
Uck1 C A 2: 32,260,141 probably benign Het
Utp20 A G 10: 88,826,604 probably null Het
Vmn2r118 G T 17: 55,608,057 L530I probably benign Het
Vmn2r30 A T 7: 7,312,360 C825S probably damaging Het
Vps13d A T 4: 145,091,979 M3106K Het
Wfdc15a A T 2: 164,199,751 C51S probably damaging Het
Zc3hc1 T C 6: 30,375,952 D203G probably damaging Het
Zfhx2 G T 14: 55,070,622 D932E probably benign Het
Other mutations in Cntnap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Cntnap3 APN 13 64772731 missense probably damaging 1.00
IGL00782:Cntnap3 APN 13 64745805 splice site probably benign
IGL00976:Cntnap3 APN 13 64794352 missense probably damaging 1.00
IGL01319:Cntnap3 APN 13 64787837 missense probably damaging 1.00
IGL01610:Cntnap3 APN 13 64757301 missense probably damaging 0.98
IGL01861:Cntnap3 APN 13 64799108 missense probably damaging 1.00
IGL02127:Cntnap3 APN 13 64799064 splice site probably benign
IGL02133:Cntnap3 APN 13 64751673 splice site probably benign
IGL02251:Cntnap3 APN 13 64762036 missense probably damaging 1.00
IGL02272:Cntnap3 APN 13 64757411 missense probably damaging 1.00
IGL02370:Cntnap3 APN 13 64751751 missense probably benign
IGL02456:Cntnap3 APN 13 64799058 splice site probably benign
IGL02589:Cntnap3 APN 13 64792430 missense probably benign 0.08
IGL02695:Cntnap3 APN 13 64772132 missense probably benign 0.01
IGL02850:Cntnap3 APN 13 64757409 missense probably damaging 1.00
IGL03038:Cntnap3 APN 13 64741025 missense possibly damaging 0.50
IGL03188:Cntnap3 APN 13 64781745 missense probably damaging 0.97
IGL03327:Cntnap3 APN 13 64887768 nonsense probably null
PIT4480001:Cntnap3 UTSW 13 64757210 missense probably damaging 1.00
R0309:Cntnap3 UTSW 13 64757436 splice site probably benign
R0422:Cntnap3 UTSW 13 64757285 missense probably damaging 0.96
R0463:Cntnap3 UTSW 13 64778876 missense probably damaging 1.00
R0491:Cntnap3 UTSW 13 64762045 missense probably benign 0.01
R0499:Cntnap3 UTSW 13 64858678 missense probably benign 0.33
R0550:Cntnap3 UTSW 13 64762000 missense possibly damaging 0.86
R0613:Cntnap3 UTSW 13 64758414 missense probably damaging 1.00
R0666:Cntnap3 UTSW 13 64757397 missense probably damaging 1.00
R0840:Cntnap3 UTSW 13 64787910 missense possibly damaging 0.94
R1577:Cntnap3 UTSW 13 64758290 missense probably damaging 1.00
R1716:Cntnap3 UTSW 13 64762002 missense probably damaging 1.00
R1732:Cntnap3 UTSW 13 64740812 critical splice donor site probably null
R1739:Cntnap3 UTSW 13 64740592 missense probably benign 0.17
R1905:Cntnap3 UTSW 13 64903764 missense probably benign 0.04
R1988:Cntnap3 UTSW 13 64758390 missense probably damaging 1.00
R2086:Cntnap3 UTSW 13 64794262 missense possibly damaging 0.76
R3732:Cntnap3 UTSW 13 64740999 missense possibly damaging 0.73
R3808:Cntnap3 UTSW 13 64781804 missense probably damaging 0.96
R3809:Cntnap3 UTSW 13 64781804 missense probably damaging 0.96
R4384:Cntnap3 UTSW 13 64748460 missense probably damaging 1.00
R4433:Cntnap3 UTSW 13 64778853 missense possibly damaging 0.92
R4631:Cntnap3 UTSW 13 64778883 missense probably benign 0.04
R4645:Cntnap3 UTSW 13 64778788 critical splice donor site probably null
R4702:Cntnap3 UTSW 13 64778862 missense probably benign 0.17
R4876:Cntnap3 UTSW 13 64787706 missense probably benign 0.00
R4994:Cntnap3 UTSW 13 64761984 missense possibly damaging 0.55
R5043:Cntnap3 UTSW 13 64794348 missense probably damaging 1.00
R5214:Cntnap3 UTSW 13 64762010 missense probably damaging 1.00
R5403:Cntnap3 UTSW 13 64761978 missense possibly damaging 0.90
R5571:Cntnap3 UTSW 13 64903758 missense probably damaging 0.98
R5587:Cntnap3 UTSW 13 64746738 missense probably damaging 1.00
R5695:Cntnap3 UTSW 13 64787955 missense probably damaging 0.99
R5834:Cntnap3 UTSW 13 64748577 missense probably benign 0.07
R5892:Cntnap3 UTSW 13 64799180 missense probably damaging 1.00
R5950:Cntnap3 UTSW 13 64787769 missense probably damaging 1.00
R6526:Cntnap3 UTSW 13 64781888 missense possibly damaging 0.96
R6954:Cntnap3 UTSW 13 64748559 missense probably benign 0.00
R7138:Cntnap3 UTSW 13 64781725 critical splice donor site probably null
R7355:Cntnap3 UTSW 13 64771962 missense probably benign
R7425:Cntnap3 UTSW 13 64758252 missense probably damaging 1.00
R7521:Cntnap3 UTSW 13 64772001 missense probably benign 0.22
R7719:Cntnap3 UTSW 13 64772777 nonsense probably null
R7810:Cntnap3 UTSW 13 64793308 missense possibly damaging 0.73
R7871:Cntnap3 UTSW 13 64903773 missense probably benign 0.00
R8259:Cntnap3 UTSW 13 64787867 missense probably damaging 0.99
Z1176:Cntnap3 UTSW 13 64740872 frame shift probably null
Z1176:Cntnap3 UTSW 13 64792388 missense probably damaging 0.98
Z1177:Cntnap3 UTSW 13 64781892 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCATAGTCACCTAGAAGACTGCT -3'
(R):5'- TCAGCCACACTCAGGGCTC -3'

Sequencing Primer
(F):5'- GAAGACTGCTTCTGTTTCAACTC -3'
(R):5'- TGGCATGACCTCTCAAGGAACTG -3'
Posted On2020-10-20