Mutagenetix > Incidental Mutations

Incidental Mutation 'R8415:Ift140'

652916

Institutional Source

Beutler Lab

Gene Symbol

Ift140

Ensembl Gene

ENSMUSG00000024169

Gene Name

intraflagellar transport 140

Synonyms

Tce5, Wdtc2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8415 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

25016091-25099495 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 25092915 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 1271 (I1271V)

Ref Sequence

ENSEMBL: ENSMUSP00000024983 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024983] [ENSMUST00000137386]

Predicted Effect

probably damaging
Transcript: ENSMUST00000024983
AA Change: I1271V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000024983
Gene: ENSMUSG00000024169
AA Change: I1271V

Domain	Start	End	E-Value	Type
WD40	55	89	6.14e1	SMART
WD40	91	131	1.49e0	SMART
Blast:WD40	252	304	3e-15	BLAST
WD40	308	352	2.76e0	SMART
Blast:WD40	364	405	8e-17	BLAST
Blast:WD40	510	547	6e-13	BLAST
Blast:WD40	560	603	3e-7	BLAST
Blast:TPR	863	896	9e-13	BLAST
Blast:TPR	1011	1044	1e-13	BLAST
Blast:TPR	1377	1410	8e-13	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000137386

SMART Domains

Protein: ENSMUSP00000116163
Gene: ENSMUSG00000024169

Domain	Start	End	E-Value	Type
WD40	55	89	6.14e1	SMART
WD40	91	131	1.49e0	SMART
Blast:WD40	252	304	3e-15	BLAST
WD40	308	352	2.76e0	SMART
Blast:WD40	364	405	1e-16	BLAST
Blast:WD40	510	547	5e-13	BLAST
Blast:WD40	560	603	3e-7	BLAST
Blast:TPR	863	896	8e-13	BLAST
Blast:TPR	1011	1044	9e-14	BLAST

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the subunits of the intraflagellar transport (IFT) complex A. Intraflagellar transport is involved in the genesis, resorption and signaling of primary cilia. The primary cilium is a microtubule-based sensory organelle at the surface of most quiescent mammalian cells, that receives signals from its environment, such as the flow of fluid, light or odors, and transduces those signals to the nucleus. Loss of the corresponding protein in mouse results in renal cystic disease. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a reporter knock-out allele die at mid-gestation. Mice homozygous for an ENU-induced mutation exhibit cardiovascular defects and situs abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd24	A	G	10: 81,640,113	H317R	unknown	Het
Aox1	A	T	1: 58,041,479	Y29F	probably damaging	Het
Bnip2	T	C	9: 70,003,685	F304S	possibly damaging	Het
Bsn	G	A	9: 108,111,452	A2367V	probably benign	Het
Ccdc18	T	A	5: 108,216,033	V1198E	probably damaging	Het
Cnot3	T	C	7: 3,658,688	F660L	probably benign	Het
Cntnap3	A	G	13: 64,738,665	I1249T	probably benign	Het
Ctnna3	A	G	10: 63,504,130	I32V	probably benign	Het
D3Ertd254e	G	A	3: 36,165,033	G402S	probably damaging	Het
Dgkz	A	T	2: 91,940,304	S485T	possibly damaging	Het
Dpagt1	C	A	9: 44,327,185	N49K	possibly damaging	Het
Dsg3	A	T	18: 20,523,708	S212C	probably damaging	Het
Epb41l1	C	T	2: 156,526,953	A714V	probably benign	Het
Eppk1	A	G	15: 76,111,631	V350A	probably benign	Het
Frem1	T	G	4: 83,000,262	D481A	probably damaging	Het
Git2	T	C	5: 114,733,928	K532E	possibly damaging	Het
Glyr1	T	C	16: 5,036,465	H102R	probably benign	Het
Hdgfl2	C	T	17: 56,093,712	P160L	probably benign	Het
Hivep1	T	C	13: 42,155,429	S382P	probably benign	Het
Hmcn2	C	A	2: 31,391,076	L1867I	probably benign	Het
Hydin	G	A	8: 110,451,994	G1074R	probably damaging	Het
Krt28	T	A	11: 99,374,800	I14L	probably benign	Het
Lrtm2	A	T	6: 119,317,497	D224E	probably damaging	Het
Map1s	G	A	8: 70,913,266	V272M	probably damaging	Het
Mast3	A	G	8: 70,781,222	Y960H	probably damaging	Het
Mettl25	G	T	10: 105,826,141	Q323K	probably benign	Het
Mlh3	A	T	12: 85,269,080	S111T	probably benign	Het
Muc3	A	G	5: 137,143,950	L85P		Het
Myh6	C	G	14: 54,944,378	R1822P	probably damaging	Het
Myof	C	T	19: 37,995,424	G144E	probably benign	Het
Nat8f2	A	G	6: 85,868,042	S113P	probably damaging	Het
Nlrp9a	A	T	7: 26,557,500	Y181F	probably benign	Het
Nup85	A	G	11: 115,566,642	I57V	probably benign	Het
Olfr1185-ps1	T	A	2: 88,499,366	C94S	probably damaging	Het
Olfr507	C	T	7: 108,621,956	T48I	probably damaging	Het
Olfr862	T	A	9: 19,884,113	Y64F	possibly damaging	Het
Pcdhb2	A	G	18: 37,296,057	N361S	probably damaging	Het
Peg10	T	TCCA	6: 4,756,451		probably benign	Het
Phf20	C	T	2: 156,287,993	T495M	probably benign	Het
Pih1d3	A	G	1: 31,223,483	N182S	probably benign	Het
Pitpnm1	T	C	19: 4,105,454	M368T	probably benign	Het
Pter	A	G	2: 13,000,889	D291G	probably damaging	Het
Rasgrp2	T	G	19: 6,404,751	V207G	probably damaging	Het
Rnd2	A	T	11: 101,471,185	Q188L	probably benign	Het
Sh3d19	T	A	3: 86,085,056	D130E	probably benign	Het
Slc7a2	A	T	8: 40,916,359	Y617F	probably damaging	Het
Snx29	T	C	16: 11,447,427	L165P	probably damaging	Het
St7	T	C	6: 17,848,081		probably null	Het
Tas2r115	A	G	6: 132,737,835	L51P	probably damaging	Het
Tead1	C	A	7: 112,856,928	P164Q	probably benign	Het
Thop1	A	G	10: 81,078,551	Y224C	probably damaging	Het
Twf1	T	C	15: 94,579,821	*351W	probably null	Het
Uck1	C	A	2: 32,260,141		probably benign	Het
Utp20	A	G	10: 88,826,604		probably null	Het
Vmn2r118	G	T	17: 55,608,057	L530I	probably benign	Het
Vmn2r30	A	T	7: 7,312,360	C825S	probably damaging	Het
Vps13d	A	T	4: 145,091,979	M3106K		Het
Wfdc15a	A	T	2: 164,199,751	C51S	probably damaging	Het
Zc3hc1	T	C	6: 30,375,952	D203G	probably damaging	Het
Zfhx2	G	T	14: 55,070,622	D932E	probably benign	Het

Other mutations in Ift140

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00753:Ift140	APN	17	25055644	missense	probably damaging	1.00
IGL00966:Ift140	APN	17	25018802	missense	probably damaging	1.00
IGL01082:Ift140	APN	17	25048455	missense	possibly damaging	0.89
IGL01394:Ift140	APN	17	25094702	missense	probably benign	0.02
IGL01816:Ift140	APN	17	25087025	splice site	probably null
IGL01994:Ift140	APN	17	25048443	missense	probably damaging	1.00
IGL02102:Ift140	APN	17	25033130	missense	probably benign	0.03
IGL02207:Ift140	APN	17	25055598	missense	probably benign
IGL02493:Ift140	APN	17	25087924	nonsense	probably null
IGL02735:Ift140	APN	17	25034035	splice site	probably benign
IGL02902:Ift140	APN	17	25090762	missense	probably damaging	1.00
IGL03037:Ift140	APN	17	25092394	missense	probably benign	0.02
IGL03122:Ift140	APN	17	25086910	missense	probably damaging	1.00
IGL03206:Ift140	APN	17	25092826	missense	probably damaging	0.98
IGL03271:Ift140	APN	17	25087906	missense	probably damaging	1.00
IGL03358:Ift140	APN	17	25087984	missense	probably damaging	1.00
PIT4515001:Ift140	UTSW	17	25086860	missense	probably damaging	0.98
R0100:Ift140	UTSW	17	25090954	nonsense	probably null
R0100:Ift140	UTSW	17	25090954	nonsense	probably null
R0197:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0238:Ift140	UTSW	17	25045523	nonsense	probably null
R0238:Ift140	UTSW	17	25045523	nonsense	probably null
R0239:Ift140	UTSW	17	25045523	nonsense	probably null
R0239:Ift140	UTSW	17	25045523	nonsense	probably null
R0355:Ift140	UTSW	17	25048435	nonsense	probably null
R0399:Ift140	UTSW	17	25050340	missense	possibly damaging	0.77
R0574:Ift140	UTSW	17	25051760	splice site	probably null
R0610:Ift140	UTSW	17	25035803	missense	probably benign	0.06
R0701:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0883:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0900:Ift140	UTSW	17	25035812	missense	probably benign	0.22
R1167:Ift140	UTSW	17	25035745	missense	probably benign	0.01
R1295:Ift140	UTSW	17	25088933	critical splice donor site	probably null
R1588:Ift140	UTSW	17	25087985	missense	probably damaging	1.00
R1619:Ift140	UTSW	17	25088865	missense	probably damaging	1.00
R1637:Ift140	UTSW	17	25025634	missense	probably benign	0.40
R1854:Ift140	UTSW	17	25035839	missense	probably benign	0.05
R2397:Ift140	UTSW	17	25020736	missense	probably damaging	1.00
R2510:Ift140	UTSW	17	25036308	missense	probably benign	0.02
R2918:Ift140	UTSW	17	25035831	missense	possibly damaging	0.66
R3433:Ift140	UTSW	17	25036308	missense	probably benign	0.02
R3878:Ift140	UTSW	17	25028944	missense	probably benign	0.25
R4559:Ift140	UTSW	17	25090767	missense	probably damaging	0.97
R4670:Ift140	UTSW	17	25098961	unclassified	probably benign
R4711:Ift140	UTSW	17	25094717	splice site	probably null
R4934:Ift140	UTSW	17	25048488	missense	probably benign
R4949:Ift140	UTSW	17	25094665	missense	probably benign	0.06
R4982:Ift140	UTSW	17	25036994	missense	probably damaging	0.99
R5099:Ift140	UTSW	17	25090700	missense	probably damaging	1.00
R5223:Ift140	UTSW	17	25035812	missense	probably benign	0.22
R5268:Ift140	UTSW	17	25020627	missense	possibly damaging	0.48
R5423:Ift140	UTSW	17	25033085	missense	probably damaging	0.96
R5480:Ift140	UTSW	17	25020576	missense	probably damaging	1.00
R5655:Ift140	UTSW	17	25045064	missense	probably damaging	1.00
R5756:Ift140	UTSW	17	25028813	missense	possibly damaging	0.62
R5837:Ift140	UTSW	17	25089540	missense	probably damaging	1.00
R5894:Ift140	UTSW	17	25033919	missense	possibly damaging	0.92
R5907:Ift140	UTSW	17	25092371	missense	probably benign	0.02
R5966:Ift140	UTSW	17	25094761	nonsense	probably null
R6000:Ift140	UTSW	17	25036960	missense	probably benign	0.00
R6046:Ift140	UTSW	17	25055589	missense	probably benign	0.00
R6050:Ift140	UTSW	17	25091005	missense	probably damaging	1.00
R6103:Ift140	UTSW	17	25093126	missense	probably damaging	1.00
R6239:Ift140	UTSW	17	25028972	missense	probably benign	0.26
R6287:Ift140	UTSW	17	25050434	missense	probably benign
R6539:Ift140	UTSW	17	25094669	missense	possibly damaging	0.87
R6656:Ift140	UTSW	17	25032173	missense	probably damaging	0.96
R6723:Ift140	UTSW	17	25033116	missense	probably benign	0.08
R6749:Ift140	UTSW	17	25098916	missense	probably damaging	0.99
R6892:Ift140	UTSW	17	25020546	missense	possibly damaging	0.95
R7151:Ift140	UTSW	17	25055725	missense	probably damaging	1.00
R7235:Ift140	UTSW	17	25020645	missense	possibly damaging	0.88
R7424:Ift140	UTSW	17	25037036	missense	possibly damaging	0.81
R7552:Ift140	UTSW	17	25033115	missense	probably benign	0.02
R7560:Ift140	UTSW	17	25092341	missense	probably benign	0.28
R7660:Ift140	UTSW	17	25051824	missense	probably damaging	1.00
R8105:Ift140	UTSW	17	25036975	missense	probably benign	0.01
R8437:Ift140	UTSW	17	25094677	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CTGGAACTGTACTGTCATGGAG -3'
(R):5'- TCCATGGGCCTTGTCATAGTTC -3'

Sequencing Primer
(F):5'- GTACTGTCATGGAGTTTTCAAAACC -3'
(R):5'- GTCATAGTTCTGGTATTCGTCAATC -3'

Posted On

2020-10-20