Incidental Mutation 'R8415:Ift140'
ID652916
Institutional Source Beutler Lab
Gene Symbol Ift140
Ensembl Gene ENSMUSG00000024169
Gene Nameintraflagellar transport 140
SynonymsTce5, Wdtc2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8415 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location25016091-25099495 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25092915 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 1271 (I1271V)
Ref Sequence ENSEMBL: ENSMUSP00000024983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024983] [ENSMUST00000137386]
Predicted Effect probably damaging
Transcript: ENSMUST00000024983
AA Change: I1271V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000024983
Gene: ENSMUSG00000024169
AA Change: I1271V

DomainStartEndE-ValueType
WD40 55 89 6.14e1 SMART
WD40 91 131 1.49e0 SMART
Blast:WD40 252 304 3e-15 BLAST
WD40 308 352 2.76e0 SMART
Blast:WD40 364 405 8e-17 BLAST
Blast:WD40 510 547 6e-13 BLAST
Blast:WD40 560 603 3e-7 BLAST
Blast:TPR 863 896 9e-13 BLAST
Blast:TPR 1011 1044 1e-13 BLAST
Blast:TPR 1377 1410 8e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000137386
SMART Domains Protein: ENSMUSP00000116163
Gene: ENSMUSG00000024169

DomainStartEndE-ValueType
WD40 55 89 6.14e1 SMART
WD40 91 131 1.49e0 SMART
Blast:WD40 252 304 3e-15 BLAST
WD40 308 352 2.76e0 SMART
Blast:WD40 364 405 1e-16 BLAST
Blast:WD40 510 547 5e-13 BLAST
Blast:WD40 560 603 3e-7 BLAST
Blast:TPR 863 896 8e-13 BLAST
Blast:TPR 1011 1044 9e-14 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the subunits of the intraflagellar transport (IFT) complex A. Intraflagellar transport is involved in the genesis, resorption and signaling of primary cilia. The primary cilium is a microtubule-based sensory organelle at the surface of most quiescent mammalian cells, that receives signals from its environment, such as the flow of fluid, light or odors, and transduces those signals to the nucleus. Loss of the corresponding protein in mouse results in renal cystic disease. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a reporter knock-out allele die at mid-gestation. Mice homozygous for an ENU-induced mutation exhibit cardiovascular defects and situs abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd24 A G 10: 81,640,113 H317R unknown Het
Aox1 A T 1: 58,041,479 Y29F probably damaging Het
Bnip2 T C 9: 70,003,685 F304S possibly damaging Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
Ccdc18 T A 5: 108,216,033 V1198E probably damaging Het
Cnot3 T C 7: 3,658,688 F660L probably benign Het
Cntnap3 A G 13: 64,738,665 I1249T probably benign Het
Ctnna3 A G 10: 63,504,130 I32V probably benign Het
D3Ertd254e G A 3: 36,165,033 G402S probably damaging Het
Dgkz A T 2: 91,940,304 S485T possibly damaging Het
Dpagt1 C A 9: 44,327,185 N49K possibly damaging Het
Dsg3 A T 18: 20,523,708 S212C probably damaging Het
Epb41l1 C T 2: 156,526,953 A714V probably benign Het
Eppk1 A G 15: 76,111,631 V350A probably benign Het
Frem1 T G 4: 83,000,262 D481A probably damaging Het
Git2 T C 5: 114,733,928 K532E possibly damaging Het
Glyr1 T C 16: 5,036,465 H102R probably benign Het
Hdgfl2 C T 17: 56,093,712 P160L probably benign Het
Hivep1 T C 13: 42,155,429 S382P probably benign Het
Hmcn2 C A 2: 31,391,076 L1867I probably benign Het
Hydin G A 8: 110,451,994 G1074R probably damaging Het
Krt28 T A 11: 99,374,800 I14L probably benign Het
Lrtm2 A T 6: 119,317,497 D224E probably damaging Het
Map1s G A 8: 70,913,266 V272M probably damaging Het
Mast3 A G 8: 70,781,222 Y960H probably damaging Het
Mettl25 G T 10: 105,826,141 Q323K probably benign Het
Mlh3 A T 12: 85,269,080 S111T probably benign Het
Muc3 A G 5: 137,143,950 L85P Het
Myh6 C G 14: 54,944,378 R1822P probably damaging Het
Myof C T 19: 37,995,424 G144E probably benign Het
Nat8f2 A G 6: 85,868,042 S113P probably damaging Het
Nlrp9a A T 7: 26,557,500 Y181F probably benign Het
Nup85 A G 11: 115,566,642 I57V probably benign Het
Olfr1185-ps1 T A 2: 88,499,366 C94S probably damaging Het
Olfr507 C T 7: 108,621,956 T48I probably damaging Het
Olfr862 T A 9: 19,884,113 Y64F possibly damaging Het
Pcdhb2 A G 18: 37,296,057 N361S probably damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Phf20 C T 2: 156,287,993 T495M probably benign Het
Pih1d3 A G 1: 31,223,483 N182S probably benign Het
Pitpnm1 T C 19: 4,105,454 M368T probably benign Het
Pter A G 2: 13,000,889 D291G probably damaging Het
Rasgrp2 T G 19: 6,404,751 V207G probably damaging Het
Rnd2 A T 11: 101,471,185 Q188L probably benign Het
Sh3d19 T A 3: 86,085,056 D130E probably benign Het
Slc7a2 A T 8: 40,916,359 Y617F probably damaging Het
Snx29 T C 16: 11,447,427 L165P probably damaging Het
St7 T C 6: 17,848,081 probably null Het
Tas2r115 A G 6: 132,737,835 L51P probably damaging Het
Tead1 C A 7: 112,856,928 P164Q probably benign Het
Thop1 A G 10: 81,078,551 Y224C probably damaging Het
Twf1 T C 15: 94,579,821 *351W probably null Het
Uck1 C A 2: 32,260,141 probably benign Het
Utp20 A G 10: 88,826,604 probably null Het
Vmn2r118 G T 17: 55,608,057 L530I probably benign Het
Vmn2r30 A T 7: 7,312,360 C825S probably damaging Het
Vps13d A T 4: 145,091,979 M3106K Het
Wfdc15a A T 2: 164,199,751 C51S probably damaging Het
Zc3hc1 T C 6: 30,375,952 D203G probably damaging Het
Zfhx2 G T 14: 55,070,622 D932E probably benign Het
Other mutations in Ift140
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Ift140 APN 17 25055644 missense probably damaging 1.00
IGL00966:Ift140 APN 17 25018802 missense probably damaging 1.00
IGL01082:Ift140 APN 17 25048455 missense possibly damaging 0.89
IGL01394:Ift140 APN 17 25094702 missense probably benign 0.02
IGL01816:Ift140 APN 17 25087025 splice site probably null
IGL01994:Ift140 APN 17 25048443 missense probably damaging 1.00
IGL02102:Ift140 APN 17 25033130 missense probably benign 0.03
IGL02207:Ift140 APN 17 25055598 missense probably benign
IGL02493:Ift140 APN 17 25087924 nonsense probably null
IGL02735:Ift140 APN 17 25034035 splice site probably benign
IGL02902:Ift140 APN 17 25090762 missense probably damaging 1.00
IGL03037:Ift140 APN 17 25092394 missense probably benign 0.02
IGL03122:Ift140 APN 17 25086910 missense probably damaging 1.00
IGL03206:Ift140 APN 17 25092826 missense probably damaging 0.98
IGL03271:Ift140 APN 17 25087906 missense probably damaging 1.00
IGL03358:Ift140 APN 17 25087984 missense probably damaging 1.00
PIT4515001:Ift140 UTSW 17 25086860 missense probably damaging 0.98
R0100:Ift140 UTSW 17 25090954 nonsense probably null
R0100:Ift140 UTSW 17 25090954 nonsense probably null
R0197:Ift140 UTSW 17 25090933 missense probably benign 0.09
R0238:Ift140 UTSW 17 25045523 nonsense probably null
R0238:Ift140 UTSW 17 25045523 nonsense probably null
R0239:Ift140 UTSW 17 25045523 nonsense probably null
R0239:Ift140 UTSW 17 25045523 nonsense probably null
R0355:Ift140 UTSW 17 25048435 nonsense probably null
R0399:Ift140 UTSW 17 25050340 missense possibly damaging 0.77
R0574:Ift140 UTSW 17 25051760 splice site probably null
R0610:Ift140 UTSW 17 25035803 missense probably benign 0.06
R0701:Ift140 UTSW 17 25090933 missense probably benign 0.09
R0883:Ift140 UTSW 17 25090933 missense probably benign 0.09
R0900:Ift140 UTSW 17 25035812 missense probably benign 0.22
R1167:Ift140 UTSW 17 25035745 missense probably benign 0.01
R1295:Ift140 UTSW 17 25088933 critical splice donor site probably null
R1588:Ift140 UTSW 17 25087985 missense probably damaging 1.00
R1619:Ift140 UTSW 17 25088865 missense probably damaging 1.00
R1637:Ift140 UTSW 17 25025634 missense probably benign 0.40
R1854:Ift140 UTSW 17 25035839 missense probably benign 0.05
R2397:Ift140 UTSW 17 25020736 missense probably damaging 1.00
R2510:Ift140 UTSW 17 25036308 missense probably benign 0.02
R2918:Ift140 UTSW 17 25035831 missense possibly damaging 0.66
R3433:Ift140 UTSW 17 25036308 missense probably benign 0.02
R3878:Ift140 UTSW 17 25028944 missense probably benign 0.25
R4559:Ift140 UTSW 17 25090767 missense probably damaging 0.97
R4670:Ift140 UTSW 17 25098961 unclassified probably benign
R4711:Ift140 UTSW 17 25094717 splice site probably null
R4934:Ift140 UTSW 17 25048488 missense probably benign
R4949:Ift140 UTSW 17 25094665 missense probably benign 0.06
R4982:Ift140 UTSW 17 25036994 missense probably damaging 0.99
R5099:Ift140 UTSW 17 25090700 missense probably damaging 1.00
R5223:Ift140 UTSW 17 25035812 missense probably benign 0.22
R5268:Ift140 UTSW 17 25020627 missense possibly damaging 0.48
R5423:Ift140 UTSW 17 25033085 missense probably damaging 0.96
R5480:Ift140 UTSW 17 25020576 missense probably damaging 1.00
R5655:Ift140 UTSW 17 25045064 missense probably damaging 1.00
R5756:Ift140 UTSW 17 25028813 missense possibly damaging 0.62
R5837:Ift140 UTSW 17 25089540 missense probably damaging 1.00
R5894:Ift140 UTSW 17 25033919 missense possibly damaging 0.92
R5907:Ift140 UTSW 17 25092371 missense probably benign 0.02
R5966:Ift140 UTSW 17 25094761 nonsense probably null
R6000:Ift140 UTSW 17 25036960 missense probably benign 0.00
R6046:Ift140 UTSW 17 25055589 missense probably benign 0.00
R6050:Ift140 UTSW 17 25091005 missense probably damaging 1.00
R6103:Ift140 UTSW 17 25093126 missense probably damaging 1.00
R6239:Ift140 UTSW 17 25028972 missense probably benign 0.26
R6287:Ift140 UTSW 17 25050434 missense probably benign
R6539:Ift140 UTSW 17 25094669 missense possibly damaging 0.87
R6656:Ift140 UTSW 17 25032173 missense probably damaging 0.96
R6723:Ift140 UTSW 17 25033116 missense probably benign 0.08
R6749:Ift140 UTSW 17 25098916 missense probably damaging 0.99
R6892:Ift140 UTSW 17 25020546 missense possibly damaging 0.95
R7151:Ift140 UTSW 17 25055725 missense probably damaging 1.00
R7235:Ift140 UTSW 17 25020645 missense possibly damaging 0.88
R7424:Ift140 UTSW 17 25037036 missense possibly damaging 0.81
R7552:Ift140 UTSW 17 25033115 missense probably benign 0.02
R7560:Ift140 UTSW 17 25092341 missense probably benign 0.28
R7660:Ift140 UTSW 17 25051824 missense probably damaging 1.00
R8105:Ift140 UTSW 17 25036975 missense probably benign 0.01
R8437:Ift140 UTSW 17 25094677 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGGAACTGTACTGTCATGGAG -3'
(R):5'- TCCATGGGCCTTGTCATAGTTC -3'

Sequencing Primer
(F):5'- GTACTGTCATGGAGTTTTCAAAACC -3'
(R):5'- GTCATAGTTCTGGTATTCGTCAATC -3'
Posted On2020-10-20