Incidental Mutation 'R8416:Uck1'
ID 652927
Institutional Source Beutler Lab
Gene Symbol Uck1
Ensembl Gene ENSMUSG00000002550
Gene Name uridine-cytidine kinase 1
Synonyms URK1
MMRRC Submission 067770-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8416 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 32145014-32150117 bp(-) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) C to A at 32150153 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000002625]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000002625
SMART Domains Protein: ENSMUSP00000002625
Gene: ENSMUSG00000002550

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
Pfam:CoaE 30 198 1.1e-8 PFAM
Pfam:AAA_17 31 188 3.8e-8 PFAM
Pfam:PRK 31 225 1.9e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138133
SMART Domains Protein: ENSMUSP00000125350
Gene: ENSMUSG00000002550

DomainStartEndE-ValueType
Pfam:PRK 1 151 1e-42 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a uridine-cytidine kinase that catalyzes the phosphorylation of uridine and cytidine to uridine monophosphate (UMP) and cytidine monophosphate (CMP) but not the phosphorylation of deoxyribonucleosides or purine ribonucleosides. This enzyme can also phosphorylate uridine and cytidine analogs and uses both ATP and GTP as a phosphate donor. Alternative splicing results in multiple splice variants encoding distinct isoforms. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 A G 16: 20,369,023 (GRCm39) N173S probably benign Het
Agps A G 2: 75,684,547 (GRCm39) I172V probably benign Het
Amz1 G A 5: 140,737,731 (GRCm39) W330* probably null Het
Asap1 A T 15: 64,002,072 (GRCm39) M413K possibly damaging Het
Bhmt1b T C 18: 87,774,687 (GRCm39) V70A probably damaging Het
Ccdc83 A T 7: 89,885,513 (GRCm39) W291R unknown Het
Cdh19 A T 1: 110,853,610 (GRCm39) M277K probably benign Het
Clca3a1 C A 3: 144,460,914 (GRCm39) probably null Het
Cnpy1 T C 5: 28,408,423 (GRCm39) T138A probably benign Het
Csnka2ip T C 16: 64,300,295 (GRCm39) D23G Het
Cxcr5 A T 9: 44,425,583 (GRCm39) F25I probably benign Het
Defb33 T A 8: 21,387,651 (GRCm39) *63R probably null Het
Dgkz A T 2: 91,770,649 (GRCm39) S485T possibly damaging Het
Elac1 A G 18: 73,871,927 (GRCm39) I356T probably damaging Het
Fam135a C T 1: 24,067,675 (GRCm39) D1065N probably benign Het
Fbxo10 T A 4: 45,058,942 (GRCm39) D265V possibly damaging Het
Flrt2 A G 12: 95,746,331 (GRCm39) E223G probably benign Het
Gjc2 A T 11: 59,068,334 (GRCm39) D49E probably damaging Het
Hmcn2 C A 2: 31,281,088 (GRCm39) L1867I probably benign Het
Irf2 A T 8: 47,271,887 (GRCm39) Y158F probably benign Het
Jmy T C 13: 93,634,949 (GRCm39) D289G probably damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,758,813 (GRCm39) probably benign Het
Limch1 T G 5: 67,156,649 (GRCm39) I372S probably benign Het
Lsm11 A T 11: 45,824,730 (GRCm39) W266R probably benign Het
Mboat2 G A 12: 24,984,609 (GRCm39) E147K probably damaging Het
Mctp2 T C 7: 71,852,210 (GRCm39) I439V probably benign Het
Npc2 A G 12: 84,812,131 (GRCm39) V37A probably damaging Het
Or2t29 A T 11: 58,433,778 (GRCm39) S188T possibly damaging Het
Or5b119 A T 19: 13,456,764 (GRCm39) M266K possibly damaging Het
Parp4 T C 14: 56,825,271 (GRCm39) probably null Het
Pcdhga2 A T 18: 37,803,178 (GRCm39) N341Y probably damaging Het
Pde1b G A 15: 103,423,745 (GRCm39) probably benign Het
Pde1c C T 6: 56,128,276 (GRCm39) probably null Het
Plce1 G A 19: 38,761,441 (GRCm39) V2098I possibly damaging Het
Pou2f2 G T 7: 24,815,551 (GRCm39) S72* probably null Het
Ptpru C T 4: 131,535,783 (GRCm39) R398H probably damaging Het
Rps15 A G 10: 80,128,624 (GRCm39) K7E probably benign Het
Rtn4rl2 C T 2: 84,702,951 (GRCm39) G207D probably damaging Het
Scn2a A C 2: 65,511,345 (GRCm39) L130F probably benign Het
Sh3tc1 G A 5: 35,868,256 (GRCm39) R403W probably damaging Het
Slc7a9 A G 7: 35,152,858 (GRCm39) K92R probably benign Het
Slit3 A T 11: 35,399,062 (GRCm39) E142D probably benign Het
Srpk1 A G 17: 28,813,229 (GRCm39) I505T probably damaging Het
Sult1c2 A T 17: 54,269,580 (GRCm39) I216K probably benign Het
Susd6 T A 12: 80,897,997 (GRCm39) M44K probably benign Het
Thoc5 T A 11: 4,876,068 (GRCm39) V607E probably benign Het
Tiparp A G 3: 65,438,767 (GRCm39) R28G probably benign Het
Tln1 C T 4: 43,540,116 (GRCm39) V1498I probably benign Het
Tmprss11c T G 5: 86,387,276 (GRCm39) Q214P probably damaging Het
Wdr11 G A 7: 129,232,403 (GRCm39) S937N possibly damaging Het
Zdhhc23 A T 16: 43,791,927 (GRCm39) I282K probably damaging Het
Zfp488 A G 14: 33,693,052 (GRCm39) M37T probably benign Het
Zmpste24 T C 4: 120,940,556 (GRCm39) S142G probably benign Het
Other mutations in Uck1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Uck1 APN 2 32,149,681 (GRCm39) missense probably damaging 1.00
IGL01765:Uck1 APN 2 32,148,688 (GRCm39) unclassified probably benign
IGL02028:Uck1 APN 2 32,148,149 (GRCm39) missense probably damaging 1.00
IGL02863:Uck1 APN 2 32,148,334 (GRCm39) missense probably benign 0.04
IGL03114:Uck1 APN 2 32,148,334 (GRCm39) missense probably benign 0.04
IGL03159:Uck1 APN 2 32,148,334 (GRCm39) missense probably benign 0.04
IGL03325:Uck1 APN 2 32,148,334 (GRCm39) missense probably benign 0.04
PIT4378001:Uck1 UTSW 2 32,146,046 (GRCm39) missense probably damaging 1.00
R1019:Uck1 UTSW 2 32,146,205 (GRCm39) missense possibly damaging 0.88
R1332:Uck1 UTSW 2 32,149,666 (GRCm39) missense probably damaging 1.00
R1336:Uck1 UTSW 2 32,149,666 (GRCm39) missense probably damaging 1.00
R1428:Uck1 UTSW 2 32,148,367 (GRCm39) missense probably damaging 1.00
R2173:Uck1 UTSW 2 32,146,088 (GRCm39) unclassified probably benign
R2233:Uck1 UTSW 2 32,148,315 (GRCm39) missense probably damaging 1.00
R2234:Uck1 UTSW 2 32,148,315 (GRCm39) missense probably damaging 1.00
R2938:Uck1 UTSW 2 32,146,088 (GRCm39) unclassified probably benign
R3079:Uck1 UTSW 2 32,148,089 (GRCm39) unclassified probably benign
R4667:Uck1 UTSW 2 32,146,046 (GRCm39) missense probably damaging 1.00
R5036:Uck1 UTSW 2 32,148,478 (GRCm39) unclassified probably benign
R6463:Uck1 UTSW 2 32,148,667 (GRCm39) missense probably benign 0.00
R7072:Uck1 UTSW 2 32,148,178 (GRCm39) missense probably damaging 1.00
R7690:Uck1 UTSW 2 32,148,184 (GRCm39) missense probably benign 0.03
R8021:Uck1 UTSW 2 32,149,929 (GRCm39) missense probably benign 0.17
R8415:Uck1 UTSW 2 32,150,153 (GRCm39) unclassified probably benign
R8437:Uck1 UTSW 2 32,150,153 (GRCm39) unclassified probably benign
R8438:Uck1 UTSW 2 32,150,153 (GRCm39) unclassified probably benign
R8440:Uck1 UTSW 2 32,150,153 (GRCm39) unclassified probably benign
R8442:Uck1 UTSW 2 32,150,153 (GRCm39) unclassified probably benign
R8530:Uck1 UTSW 2 32,150,153 (GRCm39) unclassified probably benign
R8537:Uck1 UTSW 2 32,150,153 (GRCm39) unclassified probably benign
R8749:Uck1 UTSW 2 32,146,524 (GRCm39) missense
R9494:Uck1 UTSW 2 32,148,179 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCTTGTGCACTGAGTGACC -3'
(R):5'- ATAAGGCAGGGACGGTCCTAAC -3'

Sequencing Primer
(F):5'- ACGACCCCCTTAGCTGCTAG -3'
(R):5'- ACGGTCCTAACCCTGTGG -3'
Posted On 2020-10-20