Incidental Mutation 'R8416:Scn2a'
ID 652928
Institutional Source Beutler Lab
Gene Symbol Scn2a
Ensembl Gene ENSMUSG00000075318
Gene Name sodium channel, voltage-gated, type II, alpha
Synonyms A230052E19Rik, Nav1.2, Scn2a1
MMRRC Submission 067770-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8416 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 65451115-65597791 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 65511345 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 130 (L130F)
Ref Sequence ENSEMBL: ENSMUSP00000028377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028377] [ENSMUST00000100067] [ENSMUST00000144254] [ENSMUST00000200829]
AlphaFold B1AWN6
Predicted Effect probably benign
Transcript: ENSMUST00000028377
AA Change: L130F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000028377
Gene: ENSMUSG00000075318
AA Change: L130F

DomainStartEndE-ValueType
Pfam:Ion_trans 128 436 2.2e-81 PFAM
low complexity region 450 471 N/A INTRINSIC
Pfam:Na_trans_cytopl 505 710 9.6e-83 PFAM
Pfam:Ion_trans 759 994 3.6e-57 PFAM
Pfam:Na_trans_assoc 998 1204 1.7e-63 PFAM
Pfam:Ion_trans 1208 1484 3.3e-66 PFAM
Pfam:Ion_trans 1531 1788 2.8e-57 PFAM
Pfam:PKD_channel 1627 1782 8.6e-7 PFAM
IQ 1905 1927 3.59e-3 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100067
AA Change: L130F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097645
Gene: ENSMUSG00000075318
AA Change: L130F

DomainStartEndE-ValueType
Pfam:Ion_trans 157 424 3.3e-75 PFAM
low complexity region 433 448 N/A INTRINSIC
low complexity region 450 471 N/A INTRINSIC
Pfam:DUF3451 488 711 2.6e-66 PFAM
Pfam:Ion_trans 794 983 1.1e-47 PFAM
Pfam:Na_trans_assoc 998 1219 3.5e-77 PFAM
Pfam:Ion_trans 1245 1473 4.4e-55 PFAM
PDB:1BYY|A 1475 1527 3e-31 PDB
Pfam:Ion_trans 1566 1776 2.4e-52 PFAM
Pfam:PKD_channel 1628 1783 3.6e-7 PFAM
IQ 1905 1927 3.59e-3 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144254
AA Change: L130F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000117955
Gene: ENSMUSG00000075318
AA Change: L130F

DomainStartEndE-ValueType
Pfam:Ion_trans 128 436 7.2e-81 PFAM
low complexity region 450 471 N/A INTRINSIC
low complexity region 484 502 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200829
AA Change: L130F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000143882
Gene: ENSMUSG00000075318
AA Change: L130F

DomainStartEndE-ValueType
Pfam:Ion_trans 128 436 1.2e-79 PFAM
low complexity region 450 471 N/A INTRINSIC
Pfam:Na_trans_cytopl 505 710 7.1e-80 PFAM
Pfam:Ion_trans 759 994 2.1e-55 PFAM
Pfam:Na_trans_assoc 998 1204 8e-61 PFAM
Pfam:Ion_trans 1208 1484 1.9e-64 PFAM
Pfam:Ion_trans 1531 1788 1.6e-55 PFAM
Pfam:PKD_channel 1627 1782 1.2e-4 PFAM
IQ 1905 1927 1.8e-5 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with four repeat domains, each of which is composed of six membrane-spanning segments, and one or more regulatory beta subunits. Voltage-gated sodium channels are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family. In humans, variants of this gene are associated with seizure disorders and autism spectrum disorder. Mice homozygous for a knockout mutation die with severe hypoxia and extensive neuronal cell death, while gain of function mutations result in progressive seizure disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygotes for a targeted mutation exhibit excess neuronal apoptosis (especially in the brainstem), reduced neuronal sodium channel currents in vitro, and severe hypoxia resulting in neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 A G 16: 20,369,023 (GRCm39) N173S probably benign Het
Agps A G 2: 75,684,547 (GRCm39) I172V probably benign Het
Amz1 G A 5: 140,737,731 (GRCm39) W330* probably null Het
Asap1 A T 15: 64,002,072 (GRCm39) M413K possibly damaging Het
Bhmt1b T C 18: 87,774,687 (GRCm39) V70A probably damaging Het
Ccdc83 A T 7: 89,885,513 (GRCm39) W291R unknown Het
Cdh19 A T 1: 110,853,610 (GRCm39) M277K probably benign Het
Clca3a1 C A 3: 144,460,914 (GRCm39) probably null Het
Cnpy1 T C 5: 28,408,423 (GRCm39) T138A probably benign Het
Csnka2ip T C 16: 64,300,295 (GRCm39) D23G Het
Cxcr5 A T 9: 44,425,583 (GRCm39) F25I probably benign Het
Defb33 T A 8: 21,387,651 (GRCm39) *63R probably null Het
Dgkz A T 2: 91,770,649 (GRCm39) S485T possibly damaging Het
Elac1 A G 18: 73,871,927 (GRCm39) I356T probably damaging Het
Fam135a C T 1: 24,067,675 (GRCm39) D1065N probably benign Het
Fbxo10 T A 4: 45,058,942 (GRCm39) D265V possibly damaging Het
Flrt2 A G 12: 95,746,331 (GRCm39) E223G probably benign Het
Gjc2 A T 11: 59,068,334 (GRCm39) D49E probably damaging Het
Hmcn2 C A 2: 31,281,088 (GRCm39) L1867I probably benign Het
Irf2 A T 8: 47,271,887 (GRCm39) Y158F probably benign Het
Jmy T C 13: 93,634,949 (GRCm39) D289G probably damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,758,813 (GRCm39) probably benign Het
Limch1 T G 5: 67,156,649 (GRCm39) I372S probably benign Het
Lsm11 A T 11: 45,824,730 (GRCm39) W266R probably benign Het
Mboat2 G A 12: 24,984,609 (GRCm39) E147K probably damaging Het
Mctp2 T C 7: 71,852,210 (GRCm39) I439V probably benign Het
Npc2 A G 12: 84,812,131 (GRCm39) V37A probably damaging Het
Or2t29 A T 11: 58,433,778 (GRCm39) S188T possibly damaging Het
Or5b119 A T 19: 13,456,764 (GRCm39) M266K possibly damaging Het
Parp4 T C 14: 56,825,271 (GRCm39) probably null Het
Pcdhga2 A T 18: 37,803,178 (GRCm39) N341Y probably damaging Het
Pde1b G A 15: 103,423,745 (GRCm39) probably benign Het
Pde1c C T 6: 56,128,276 (GRCm39) probably null Het
Plce1 G A 19: 38,761,441 (GRCm39) V2098I possibly damaging Het
Pou2f2 G T 7: 24,815,551 (GRCm39) S72* probably null Het
Ptpru C T 4: 131,535,783 (GRCm39) R398H probably damaging Het
Rps15 A G 10: 80,128,624 (GRCm39) K7E probably benign Het
Rtn4rl2 C T 2: 84,702,951 (GRCm39) G207D probably damaging Het
Sh3tc1 G A 5: 35,868,256 (GRCm39) R403W probably damaging Het
Slc7a9 A G 7: 35,152,858 (GRCm39) K92R probably benign Het
Slit3 A T 11: 35,399,062 (GRCm39) E142D probably benign Het
Srpk1 A G 17: 28,813,229 (GRCm39) I505T probably damaging Het
Sult1c2 A T 17: 54,269,580 (GRCm39) I216K probably benign Het
Susd6 T A 12: 80,897,997 (GRCm39) M44K probably benign Het
Thoc5 T A 11: 4,876,068 (GRCm39) V607E probably benign Het
Tiparp A G 3: 65,438,767 (GRCm39) R28G probably benign Het
Tln1 C T 4: 43,540,116 (GRCm39) V1498I probably benign Het
Tmprss11c T G 5: 86,387,276 (GRCm39) Q214P probably damaging Het
Uck1 C A 2: 32,150,153 (GRCm39) probably benign Het
Wdr11 G A 7: 129,232,403 (GRCm39) S937N possibly damaging Het
Zdhhc23 A T 16: 43,791,927 (GRCm39) I282K probably damaging Het
Zfp488 A G 14: 33,693,052 (GRCm39) M37T probably benign Het
Zmpste24 T C 4: 120,940,556 (GRCm39) S142G probably benign Het
Other mutations in Scn2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Scn2a APN 2 65,594,784 (GRCm39) missense probably benign
IGL00159:Scn2a APN 2 65,573,434 (GRCm39) missense probably damaging 1.00
IGL00418:Scn2a APN 2 65,594,866 (GRCm39) missense probably benign 0.43
IGL00753:Scn2a APN 2 65,514,207 (GRCm39) missense possibly damaging 0.66
IGL00770:Scn2a APN 2 65,566,197 (GRCm39) missense probably damaging 1.00
IGL00774:Scn2a APN 2 65,566,197 (GRCm39) missense probably damaging 1.00
IGL00847:Scn2a APN 2 65,501,078 (GRCm39) missense probably damaging 1.00
IGL01155:Scn2a APN 2 65,548,092 (GRCm39) missense probably damaging 1.00
IGL01329:Scn2a APN 2 65,547,852 (GRCm39) missense probably benign 0.05
IGL01537:Scn2a APN 2 65,546,219 (GRCm39) missense probably benign 0.00
IGL01672:Scn2a APN 2 65,582,278 (GRCm39) missense probably damaging 1.00
IGL01958:Scn2a APN 2 65,532,173 (GRCm39) missense probably damaging 1.00
IGL02028:Scn2a APN 2 65,594,002 (GRCm39) missense probably damaging 0.96
IGL02142:Scn2a APN 2 65,546,182 (GRCm39) missense probably damaging 1.00
IGL02160:Scn2a APN 2 65,560,460 (GRCm39) missense probably damaging 1.00
IGL02183:Scn2a APN 2 65,501,947 (GRCm39) missense probably benign 0.20
IGL02341:Scn2a APN 2 65,518,721 (GRCm39) missense probably damaging 1.00
IGL02504:Scn2a APN 2 65,514,228 (GRCm39) missense probably benign 0.02
IGL02530:Scn2a APN 2 65,560,522 (GRCm39) missense probably damaging 0.99
IGL02621:Scn2a APN 2 65,579,223 (GRCm39) splice site probably benign
IGL02652:Scn2a APN 2 65,532,382 (GRCm39) missense possibly damaging 0.82
IGL02966:Scn2a APN 2 65,532,188 (GRCm39) missense possibly damaging 0.93
IGL03188:Scn2a APN 2 65,501,997 (GRCm39) missense probably damaging 0.99
IGL03329:Scn2a APN 2 65,594,973 (GRCm39) missense probably benign
IGL03336:Scn2a APN 2 65,519,088 (GRCm39) missense probably damaging 1.00
IGL03391:Scn2a APN 2 65,594,557 (GRCm39) missense probably damaging 1.00
PIT4280001:Scn2a UTSW 2 65,546,074 (GRCm39) missense probably damaging 1.00
PIT4362001:Scn2a UTSW 2 65,514,182 (GRCm39) missense probably benign 0.09
PIT4403001:Scn2a UTSW 2 65,542,252 (GRCm39) missense probably damaging 1.00
PIT4520001:Scn2a UTSW 2 65,518,763 (GRCm39) missense probably damaging 1.00
R0021:Scn2a UTSW 2 65,500,859 (GRCm39) missense possibly damaging 0.51
R0141:Scn2a UTSW 2 65,542,160 (GRCm39) missense probably benign 0.01
R0240:Scn2a UTSW 2 65,566,118 (GRCm39) missense probably benign 0.32
R0240:Scn2a UTSW 2 65,566,118 (GRCm39) missense probably benign 0.32
R0335:Scn2a UTSW 2 65,512,435 (GRCm39) missense probably damaging 1.00
R0508:Scn2a UTSW 2 65,548,186 (GRCm39) missense probably damaging 0.99
R0558:Scn2a UTSW 2 65,542,269 (GRCm39) missense probably benign 0.26
R0600:Scn2a UTSW 2 65,532,177 (GRCm39) missense possibly damaging 0.90
R0667:Scn2a UTSW 2 65,582,340 (GRCm39) missense possibly damaging 0.91
R1178:Scn2a UTSW 2 65,517,123 (GRCm39) splice site probably benign
R1244:Scn2a UTSW 2 65,593,999 (GRCm39) missense probably damaging 0.98
R1386:Scn2a UTSW 2 65,519,085 (GRCm39) missense probably damaging 1.00
R1434:Scn2a UTSW 2 65,532,335 (GRCm39) missense possibly damaging 0.79
R1440:Scn2a UTSW 2 65,594,938 (GRCm39) missense probably benign
R1448:Scn2a UTSW 2 65,514,189 (GRCm39) missense probably benign 0.17
R1460:Scn2a UTSW 2 65,532,187 (GRCm39) missense probably damaging 0.96
R1553:Scn2a UTSW 2 65,544,180 (GRCm39) nonsense probably null
R1642:Scn2a UTSW 2 65,514,041 (GRCm39) missense probably damaging 1.00
R1803:Scn2a UTSW 2 65,501,111 (GRCm39) splice site probably null
R1981:Scn2a UTSW 2 65,520,514 (GRCm39) missense probably damaging 1.00
R2002:Scn2a UTSW 2 65,512,427 (GRCm39) missense probably null 1.00
R2068:Scn2a UTSW 2 65,582,417 (GRCm39) missense probably benign 0.14
R2125:Scn2a UTSW 2 65,582,423 (GRCm39) nonsense probably null
R2126:Scn2a UTSW 2 65,582,423 (GRCm39) nonsense probably null
R2876:Scn2a UTSW 2 65,546,241 (GRCm39) missense possibly damaging 0.64
R2878:Scn2a UTSW 2 65,518,715 (GRCm39) missense probably damaging 1.00
R3113:Scn2a UTSW 2 65,579,129 (GRCm39) missense possibly damaging 0.86
R3749:Scn2a UTSW 2 65,544,115 (GRCm39) missense probably damaging 1.00
R3750:Scn2a UTSW 2 65,544,115 (GRCm39) missense probably damaging 1.00
R3765:Scn2a UTSW 2 65,513,054 (GRCm39) missense possibly damaging 0.51
R3850:Scn2a UTSW 2 65,512,375 (GRCm39) missense probably benign 0.14
R4585:Scn2a UTSW 2 65,573,395 (GRCm39) splice site probably null
R4586:Scn2a UTSW 2 65,573,395 (GRCm39) splice site probably null
R4588:Scn2a UTSW 2 65,544,111 (GRCm39) missense possibly damaging 0.76
R4622:Scn2a UTSW 2 65,582,371 (GRCm39) missense probably benign 0.04
R5108:Scn2a UTSW 2 65,518,974 (GRCm39) missense probably damaging 1.00
R5161:Scn2a UTSW 2 65,594,935 (GRCm39) missense probably benign 0.00
R5235:Scn2a UTSW 2 65,582,355 (GRCm39) missense probably damaging 1.00
R5464:Scn2a UTSW 2 65,532,100 (GRCm39) missense probably damaging 1.00
R5586:Scn2a UTSW 2 65,537,639 (GRCm39) nonsense probably null
R5630:Scn2a UTSW 2 65,556,709 (GRCm39) missense probably damaging 1.00
R5715:Scn2a UTSW 2 65,547,928 (GRCm39) missense probably benign 0.27
R5730:Scn2a UTSW 2 65,512,882 (GRCm39) nonsense probably null
R5734:Scn2a UTSW 2 65,548,066 (GRCm39) missense possibly damaging 0.49
R5779:Scn2a UTSW 2 65,594,827 (GRCm39) missense probably benign 0.00
R6133:Scn2a UTSW 2 65,573,448 (GRCm39) missense probably benign 0.35
R6547:Scn2a UTSW 2 65,546,241 (GRCm39) missense probably benign 0.29
R6549:Scn2a UTSW 2 65,595,018 (GRCm39) missense probably benign 0.05
R6818:Scn2a UTSW 2 65,519,013 (GRCm39) nonsense probably null
R6999:Scn2a UTSW 2 65,512,453 (GRCm39) missense probably benign
R7069:Scn2a UTSW 2 65,594,950 (GRCm39) missense probably benign 0.00
R7073:Scn2a UTSW 2 65,558,787 (GRCm39) missense probably benign 0.00
R7125:Scn2a UTSW 2 65,594,277 (GRCm39) missense probably damaging 1.00
R7178:Scn2a UTSW 2 65,579,197 (GRCm39) nonsense probably null
R7179:Scn2a UTSW 2 65,532,323 (GRCm39) missense probably damaging 1.00
R7203:Scn2a UTSW 2 65,578,663 (GRCm39) missense probably benign 0.01
R7227:Scn2a UTSW 2 65,582,367 (GRCm39) missense probably damaging 0.98
R7269:Scn2a UTSW 2 65,594,113 (GRCm39) missense probably damaging 1.00
R7358:Scn2a UTSW 2 65,512,850 (GRCm39) nonsense probably null
R7388:Scn2a UTSW 2 65,518,998 (GRCm39) missense probably damaging 1.00
R7491:Scn2a UTSW 2 65,532,352 (GRCm39) missense probably damaging 0.99
R7619:Scn2a UTSW 2 65,546,247 (GRCm39) missense probably damaging 1.00
R7695:Scn2a UTSW 2 65,542,251 (GRCm39) missense probably damaging 0.99
R7735:Scn2a UTSW 2 65,594,013 (GRCm39) missense probably benign 0.40
R7911:Scn2a UTSW 2 65,512,427 (GRCm39) missense probably null 1.00
R8096:Scn2a UTSW 2 65,594,366 (GRCm39) missense probably damaging 0.98
R8172:Scn2a UTSW 2 65,520,672 (GRCm39) missense probably benign 0.01
R8220:Scn2a UTSW 2 65,520,620 (GRCm39) missense probably benign 0.01
R8333:Scn2a UTSW 2 65,514,191 (GRCm39) missense probably benign 0.01
R8850:Scn2a UTSW 2 65,518,730 (GRCm39) missense probably damaging 1.00
R8897:Scn2a UTSW 2 65,546,002 (GRCm39) critical splice acceptor site probably null
R8977:Scn2a UTSW 2 65,594,014 (GRCm39) missense probably damaging 0.99
R8992:Scn2a UTSW 2 65,594,242 (GRCm39) missense probably damaging 1.00
R9190:Scn2a UTSW 2 65,511,346 (GRCm39) missense probably benign 0.00
R9206:Scn2a UTSW 2 65,548,131 (GRCm39) missense probably damaging 1.00
R9355:Scn2a UTSW 2 65,594,433 (GRCm39) missense probably damaging 1.00
R9452:Scn2a UTSW 2 65,595,163 (GRCm39) missense probably benign
R9529:Scn2a UTSW 2 65,594,932 (GRCm39) missense probably damaging 0.99
R9567:Scn2a UTSW 2 65,518,974 (GRCm39) missense probably damaging 1.00
R9569:Scn2a UTSW 2 65,560,622 (GRCm39) missense probably damaging 1.00
R9657:Scn2a UTSW 2 65,566,032 (GRCm39) missense probably damaging 1.00
R9715:Scn2a UTSW 2 65,579,149 (GRCm39) missense possibly damaging 0.93
R9761:Scn2a UTSW 2 65,566,030 (GRCm39) missense probably damaging 1.00
Z1176:Scn2a UTSW 2 65,582,212 (GRCm39) missense possibly damaging 0.84
Z1177:Scn2a UTSW 2 65,548,079 (GRCm39) missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- ATCTGGTTGAGTCTATGGTGAAGAC -3'
(R):5'- GGCATGGATTTGAACCATCTG -3'

Sequencing Primer
(F):5'- TTTCTTACTCGTCTGAAGACAATTG -3'
(R):5'- GAACCATCTGTTTTAGCATGGTTAG -3'
Posted On 2020-10-20