Incidental Mutation 'R8416:Tmprss11c'
ID652941
Institutional Source Beutler Lab
Gene Symbol Tmprss11c
Ensembl Gene ENSMUSG00000061184
Gene Nametransmembrane protease, serine 11c
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8416 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location86231481-86289308 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 86239417 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 214 (Q214P)
Ref Sequence ENSEMBL: ENSMUSP00000062915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059424] [ENSMUST00000196462]
Predicted Effect probably damaging
Transcript: ENSMUST00000059424
AA Change: Q214P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062915
Gene: ENSMUSG00000061184
AA Change: Q214P

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
SEA 58 183 5.19e-3 SMART
Tryp_SPc 199 425 8.42e-91 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000196462
AA Change: Q201P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142902
Gene: ENSMUSG00000061184
AA Change: Q201P

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
SEA 58 176 3.6e-4 SMART
Tryp_SPc 186 412 4.1e-93 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 A G 16: 20,550,273 N173S probably benign Het
Agps A G 2: 75,854,203 I172V probably benign Het
Amz1 G A 5: 140,751,976 W330* probably null Het
Asap1 A T 15: 64,130,223 M413K possibly damaging Het
Ccdc83 A T 7: 90,236,305 W291R unknown Het
Cdh19 A T 1: 110,925,880 M277K probably benign Het
Clca3a1 C A 3: 144,755,153 probably null Het
Cnpy1 T C 5: 28,203,425 T138A probably benign Het
Csnka2ip T C 16: 64,479,932 D23G Het
Cxcr5 A T 9: 44,514,286 F25I probably benign Het
Defb33 T A 8: 20,897,635 *63R probably null Het
Dgkz A T 2: 91,940,304 S485T possibly damaging Het
Elac1 A G 18: 73,738,856 I356T probably damaging Het
Fam135a C T 1: 24,028,594 D1065N probably benign Het
Fbxo10 T A 4: 45,058,942 D265V possibly damaging Het
Flrt2 A G 12: 95,779,557 E223G probably benign Het
Gjc2 A T 11: 59,177,508 D49E probably damaging Het
Gm5096 T C 18: 87,756,563 V70A probably damaging Het
Hmcn2 C A 2: 31,391,076 L1867I probably benign Het
Irf2 A T 8: 46,818,852 Y158F probably benign Het
Jmy T C 13: 93,498,441 D289G probably damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Limch1 T G 5: 66,999,306 I372S probably benign Het
Lsm11 A T 11: 45,933,903 W266R probably benign Het
Mboat2 G A 12: 24,934,610 E147K probably damaging Het
Mctp2 T C 7: 72,202,462 I439V probably benign Het
Npc2 A G 12: 84,765,357 V37A probably damaging Het
Olfr1475 A T 19: 13,479,400 M266K possibly damaging Het
Olfr329-ps A T 11: 58,542,952 S188T possibly damaging Het
Parp4 T C 14: 56,587,814 probably null Het
Pcdhga2 A T 18: 37,670,125 N341Y probably damaging Het
Pde1b G A 15: 103,515,318 probably benign Het
Pde1c C T 6: 56,151,291 probably null Het
Plce1 G A 19: 38,772,997 V2098I possibly damaging Het
Pou2f2 G T 7: 25,116,126 S72* probably null Het
Ptpru C T 4: 131,808,472 R398H probably damaging Het
Rps15 A G 10: 80,292,790 K7E probably benign Het
Rtn4rl2 C T 2: 84,872,607 G207D probably damaging Het
Scn2a A C 2: 65,681,001 L130F probably benign Het
Sh3tc1 G A 5: 35,710,912 R403W probably damaging Het
Slc7a9 A G 7: 35,453,433 K92R probably benign Het
Slit3 A T 11: 35,508,235 E142D probably benign Het
Srpk1 A G 17: 28,594,255 I505T probably damaging Het
Sult1c1 A T 17: 53,962,552 I216K probably benign Het
Susd6 T A 12: 80,851,223 M44K probably benign Het
Thoc5 T A 11: 4,926,068 V607E probably benign Het
Tiparp A G 3: 65,531,346 R28G probably benign Het
Tln1 C T 4: 43,540,116 V1498I probably benign Het
Uck1 C A 2: 32,260,141 probably benign Het
Wdr11 G A 7: 129,630,679 S937N possibly damaging Het
Zdhhc23 A T 16: 43,971,564 I282K probably damaging Het
Zfp488 A G 14: 33,971,095 M37T probably benign Het
Zmpste24 T C 4: 121,083,359 S142G probably benign Het
Other mutations in Tmprss11c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Tmprss11c APN 5 86239395 missense probably benign 0.00
IGL01357:Tmprss11c APN 5 86231807 missense probably damaging 1.00
IGL01809:Tmprss11c APN 5 86237662 missense possibly damaging 0.89
IGL02972:Tmprss11c APN 5 86237833 missense possibly damaging 0.77
IGL03135:Tmprss11c APN 5 86237650 missense probably damaging 1.00
IGL03255:Tmprss11c APN 5 86271482 missense probably damaging 0.99
IGL03355:Tmprss11c APN 5 86231871 missense probably benign 0.03
R0165:Tmprss11c UTSW 5 86231927 splice site probably benign
R0285:Tmprss11c UTSW 5 86271430 missense probably damaging 1.00
R0480:Tmprss11c UTSW 5 86237609 splice site probably benign
R0639:Tmprss11c UTSW 5 86235469 missense probably damaging 1.00
R1554:Tmprss11c UTSW 5 86289260 start codon destroyed possibly damaging 0.59
R1651:Tmprss11c UTSW 5 86239424 missense probably damaging 1.00
R2234:Tmprss11c UTSW 5 86282086 missense probably benign 0.12
R2235:Tmprss11c UTSW 5 86282086 missense probably benign 0.12
R2698:Tmprss11c UTSW 5 86271463 missense probably damaging 1.00
R4787:Tmprss11c UTSW 5 86256453 missense probably benign 0.00
R4962:Tmprss11c UTSW 5 86237710 missense probably damaging 1.00
R5063:Tmprss11c UTSW 5 86237830 missense probably benign 0.28
R5217:Tmprss11c UTSW 5 86256390 missense probably benign
R5366:Tmprss11c UTSW 5 86282134 missense possibly damaging 0.93
R6343:Tmprss11c UTSW 5 86256345 missense probably damaging 1.00
R6598:Tmprss11c UTSW 5 86289233 missense probably benign 0.01
R6681:Tmprss11c UTSW 5 86289260 start codon destroyed possibly damaging 0.59
R7170:Tmprss11c UTSW 5 86237619 critical splice donor site probably null
R7198:Tmprss11c UTSW 5 86231832 missense probably damaging 1.00
R7258:Tmprss11c UTSW 5 86271413 missense probably damaging 1.00
R7382:Tmprss11c UTSW 5 86231864 missense probably benign 0.19
R7391:Tmprss11c UTSW 5 86237791 missense probably damaging 1.00
R7590:Tmprss11c UTSW 5 86239473 missense probably benign 0.01
R7894:Tmprss11c UTSW 5 86231796 missense probably damaging 1.00
R8164:Tmprss11c UTSW 5 86231853 missense probably damaging 1.00
R8311:Tmprss11c UTSW 5 86235553 missense probably damaging 1.00
R8426:Tmprss11c UTSW 5 86231818 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTTGGGGACATAGCTACGTG -3'
(R):5'- TAAGTTCTCCCTGACAGTGAGG -3'

Sequencing Primer
(F):5'- TTGGGGACATAGCTACGTGAACAC -3'
(R):5'- ACAGTGAGGTTTTTCTCAGCTAC -3'
Posted On2020-10-20