Incidental Mutation 'R8416:Thoc5'
ID652953
Institutional Source Beutler Lab
Gene Symbol Thoc5
Ensembl Gene ENSMUSG00000034274
Gene NameTHO complex 5
Synonyms1700060C24Rik, PK1.3, A430085L24Rik, Fmip
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8416 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location4895320-4928867 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4926068 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 607 (V607E)
Ref Sequence ENSEMBL: ENSMUSP00000045580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038237] [ENSMUST00000101615]
Predicted Effect probably benign
Transcript: ENSMUST00000038237
AA Change: V607E

PolyPhen 2 Score 0.408 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000045580
Gene: ENSMUSG00000034274
AA Change: V607E

DomainStartEndE-ValueType
Pfam:FimP 97 452 1.1e-133 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000101615
AA Change: V559E

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099137
Gene: ENSMUSG00000034274
AA Change: V559E

DomainStartEndE-ValueType
low complexity region 34 41 N/A INTRINSIC
Pfam:FimP 48 405 7.5e-142 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality prior to E5.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 A G 16: 20,550,273 N173S probably benign Het
Agps A G 2: 75,854,203 I172V probably benign Het
Amz1 G A 5: 140,751,976 W330* probably null Het
Asap1 A T 15: 64,130,223 M413K possibly damaging Het
Ccdc83 A T 7: 90,236,305 W291R unknown Het
Cdh19 A T 1: 110,925,880 M277K probably benign Het
Clca3a1 C A 3: 144,755,153 probably null Het
Cnpy1 T C 5: 28,203,425 T138A probably benign Het
Csnka2ip T C 16: 64,479,932 D23G Het
Cxcr5 A T 9: 44,514,286 F25I probably benign Het
Defb33 T A 8: 20,897,635 *63R probably null Het
Dgkz A T 2: 91,940,304 S485T possibly damaging Het
Elac1 A G 18: 73,738,856 I356T probably damaging Het
Fam135a C T 1: 24,028,594 D1065N probably benign Het
Fbxo10 T A 4: 45,058,942 D265V possibly damaging Het
Flrt2 A G 12: 95,779,557 E223G probably benign Het
Gjc2 A T 11: 59,177,508 D49E probably damaging Het
Gm5096 T C 18: 87,756,563 V70A probably damaging Het
Hmcn2 C A 2: 31,391,076 L1867I probably benign Het
Irf2 A T 8: 46,818,852 Y158F probably benign Het
Jmy T C 13: 93,498,441 D289G probably damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Limch1 T G 5: 66,999,306 I372S probably benign Het
Lsm11 A T 11: 45,933,903 W266R probably benign Het
Mboat2 G A 12: 24,934,610 E147K probably damaging Het
Mctp2 T C 7: 72,202,462 I439V probably benign Het
Npc2 A G 12: 84,765,357 V37A probably damaging Het
Olfr1475 A T 19: 13,479,400 M266K possibly damaging Het
Olfr329-ps A T 11: 58,542,952 S188T possibly damaging Het
Parp4 T C 14: 56,587,814 probably null Het
Pcdhga2 A T 18: 37,670,125 N341Y probably damaging Het
Pde1b G A 15: 103,515,318 probably benign Het
Pde1c C T 6: 56,151,291 probably null Het
Plce1 G A 19: 38,772,997 V2098I possibly damaging Het
Pou2f2 G T 7: 25,116,126 S72* probably null Het
Ptpru C T 4: 131,808,472 R398H probably damaging Het
Rps15 A G 10: 80,292,790 K7E probably benign Het
Rtn4rl2 C T 2: 84,872,607 G207D probably damaging Het
Scn2a A C 2: 65,681,001 L130F probably benign Het
Sh3tc1 G A 5: 35,710,912 R403W probably damaging Het
Slc7a9 A G 7: 35,453,433 K92R probably benign Het
Slit3 A T 11: 35,508,235 E142D probably benign Het
Srpk1 A G 17: 28,594,255 I505T probably damaging Het
Sult1c1 A T 17: 53,962,552 I216K probably benign Het
Susd6 T A 12: 80,851,223 M44K probably benign Het
Tiparp A G 3: 65,531,346 R28G probably benign Het
Tln1 C T 4: 43,540,116 V1498I probably benign Het
Tmprss11c T G 5: 86,239,417 Q214P probably damaging Het
Uck1 C A 2: 32,260,141 probably benign Het
Wdr11 G A 7: 129,630,679 S937N possibly damaging Het
Zdhhc23 A T 16: 43,971,564 I282K probably damaging Het
Zfp488 A G 14: 33,971,095 M37T probably benign Het
Zmpste24 T C 4: 121,083,359 S142G probably benign Het
Other mutations in Thoc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Thoc5 APN 11 4918147 missense probably damaging 0.96
IGL02039:Thoc5 APN 11 4922027 critical splice donor site probably null
IGL02227:Thoc5 APN 11 4926217 missense probably benign 0.02
IGL02970:Thoc5 APN 11 4904201 missense probably damaging 0.99
R0398:Thoc5 UTSW 11 4921978 missense possibly damaging 0.84
R0401:Thoc5 UTSW 11 4902213 utr 5 prime probably benign
R0453:Thoc5 UTSW 11 4918217 missense possibly damaging 0.60
R1223:Thoc5 UTSW 11 4921922 missense probably benign 0.40
R1438:Thoc5 UTSW 11 4911427 splice site probably benign
R1661:Thoc5 UTSW 11 4919792 missense probably benign 0.04
R1665:Thoc5 UTSW 11 4919792 missense probably benign 0.04
R1776:Thoc5 UTSW 11 4914517 splice site probably benign
R1830:Thoc5 UTSW 11 4914608 missense probably benign 0.02
R1912:Thoc5 UTSW 11 4915561 missense probably benign 0.15
R3001:Thoc5 UTSW 11 4928688 missense probably benign
R3002:Thoc5 UTSW 11 4928688 missense probably benign
R3783:Thoc5 UTSW 11 4920372 unclassified probably benign
R4534:Thoc5 UTSW 11 4924807 nonsense probably null
R4619:Thoc5 UTSW 11 4926218 missense probably damaging 0.96
R4747:Thoc5 UTSW 11 4904187 missense probably damaging 0.99
R5106:Thoc5 UTSW 11 4910630 missense probably damaging 1.00
R5310:Thoc5 UTSW 11 4910648 missense probably damaging 1.00
R5914:Thoc5 UTSW 11 4920416 missense possibly damaging 0.58
R5936:Thoc5 UTSW 11 4904133 missense probably damaging 1.00
R6167:Thoc5 UTSW 11 4915497 missense probably benign 0.12
R6209:Thoc5 UTSW 11 4905697 missense probably damaging 1.00
R6243:Thoc5 UTSW 11 4919753 missense possibly damaging 0.59
R6504:Thoc5 UTSW 11 4924815 nonsense probably null
R6833:Thoc5 UTSW 11 4919804 missense probably damaging 1.00
R6874:Thoc5 UTSW 11 4901261 missense probably damaging 1.00
R7048:Thoc5 UTSW 11 4926237 critical splice donor site probably null
R7197:Thoc5 UTSW 11 4915563 missense probably benign 0.01
R7753:Thoc5 UTSW 11 4902156 missense probably damaging 0.99
R7828:Thoc5 UTSW 11 4902306 start gained probably benign
R8428:Thoc5 UTSW 11 4926115 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTCTGGACGAGGTTGTAGC -3'
(R):5'- AGGACTGCGATCTCTGTTCAC -3'

Sequencing Primer
(F):5'- TGTAGCCCAGCTGTGTACAGATC -3'
(R):5'- TCCTTGAGGAAAGTCACAAGAGCC -3'
Posted On2020-10-20