Incidental Mutation 'R8417:Fcna'
ID652980
Institutional Source Beutler Lab
Gene Symbol Fcna
Ensembl Gene ENSMUSG00000026938
Gene Nameficolin A
SynonymsFcn1, ficolin A
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8417 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location25624666-25628030 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 25624851 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 332 (R332L)
Ref Sequence ENSEMBL: ENSMUSP00000028307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028307] [ENSMUST00000142087]
Predicted Effect probably damaging
Transcript: ENSMUST00000028307
AA Change: R332L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028307
Gene: ENSMUSG00000026938
AA Change: R332L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Collagen 48 108 2e-10 PFAM
FBG 121 334 2.18e-110 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000028308
SMART Domains Protein: ENSMUSP00000028308
Gene: ENSMUSG00000026939

DomainStartEndE-ValueType
Pfam:TMEM141 6 94 1.5e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142087
SMART Domains Protein: ENSMUSP00000121862
Gene: ENSMUSG00000026939

DomainStartEndE-ValueType
Pfam:TMEM141 2 97 1e-43 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal collagen antibody-induced arthritis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AB124611 T C 9: 21,529,085 probably null Het
Adamtsl1 G A 4: 86,156,689 D98N possibly damaging Het
Adgrb3 T C 1: 25,488,053 T601A probably benign Het
Ankrd33 C A 15: 101,119,449 Q248K probably benign Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
Casp12 G T 9: 5,352,263 C155F probably benign Het
Clpp T C 17: 56,990,661 V81A probably benign Het
Cyp3a59 A T 5: 146,090,685 I89F possibly damaging Het
Fam227b C A 2: 126,121,062 W178L probably damaging Het
Gdf3 T G 6: 122,606,607 H267P probably damaging Het
Gm4450 G A 3: 98,456,415 T38I probably benign Het
Gm5592 A G 7: 41,288,551 D419G probably benign Het
Gm6882 A G 7: 21,427,295 V216A probably damaging Het
Gsdma3 A G 11: 98,629,777 N78S probably benign Het
Hydin T C 8: 110,569,392 I3579T probably benign Het
Ighmbp2 T C 19: 3,261,590 I942V probably damaging Het
Lamc1 A G 1: 153,230,769 Y1266H probably damaging Het
Lgi3 T C 14: 70,534,806 Y264H probably benign Het
Lmod2 G A 6: 24,603,385 E120K possibly damaging Het
Mbl2 G T 19: 30,239,484 C232F probably damaging Het
Morc1 T C 16: 48,460,740 V214A probably damaging Het
Nlrp4b T A 7: 10,725,953 C827* probably null Het
Olfr1086 A G 2: 86,676,805 F176S probably damaging Het
Olfr358 T A 2: 37,004,646 T323S probably benign Het
Pbrm1 T A 14: 31,027,462 H72Q possibly damaging Het
Plekhm2 T C 4: 141,627,825 I944V probably benign Het
Prdm8 A T 5: 98,184,531 D97V probably damaging Het
Preb G A 5: 30,960,117 probably benign Het
Prkcd T C 14: 30,609,251 K56E probably benign Het
Slit3 A T 11: 35,610,611 I391F probably damaging Het
Spata19 A G 9: 27,397,970 S91G probably benign Het
Stag3 A G 5: 138,308,588 T1134A probably benign Het
Tgfbr2 A T 9: 116,110,129 M235K probably benign Het
Tmtc2 A T 10: 105,413,236 I212N probably damaging Het
Tnfrsf26 C T 7: 143,614,902 R133K probably benign Het
Trim43c C A 9: 88,843,138 Q238K probably benign Het
Vcan T C 13: 89,688,743 D2894G probably benign Het
Wisp3 T A 10: 39,151,211 R342* probably null Het
Zeb2 C T 2: 45,022,996 S105N probably damaging Het
Other mutations in Fcna
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01945:Fcna APN 2 25627835 start codon destroyed probably null 0.53
IGL02479:Fcna APN 2 25625260 missense probably benign 0.02
IGL02488:Fcna APN 2 25625211 critical splice donor site probably null
IGL02984:Fcna UTSW 2 25630681 unclassified probably benign
IGL02988:Fcna UTSW 2 25630681 unclassified probably benign
IGL02991:Fcna UTSW 2 25630681 unclassified probably benign
IGL03014:Fcna UTSW 2 25630681 unclassified probably benign
IGL03046:Fcna UTSW 2 25630681 unclassified probably benign
IGL03048:Fcna UTSW 2 25630681 unclassified probably benign
IGL03052:Fcna UTSW 2 25630681 unclassified probably benign
IGL03055:Fcna UTSW 2 25630681 unclassified probably benign
IGL03138:Fcna UTSW 2 25630681 unclassified probably benign
R0318:Fcna UTSW 2 25625059 missense probably benign
R0455:Fcna UTSW 2 25625508 missense probably damaging 1.00
R2212:Fcna UTSW 2 25627493 missense probably damaging 1.00
R3413:Fcna UTSW 2 25627493 missense probably damaging 1.00
R3414:Fcna UTSW 2 25627493 missense probably damaging 1.00
R3854:Fcna UTSW 2 25627772 missense possibly damaging 0.76
R4007:Fcna UTSW 2 25626006 splice site probably null
R4448:Fcna UTSW 2 25625476 missense probably damaging 1.00
R4782:Fcna UTSW 2 25625326 missense probably damaging 1.00
R4831:Fcna UTSW 2 25625341 missense probably benign 0.11
R7255:Fcna UTSW 2 25626028 missense probably damaging 0.99
R7920:Fcna UTSW 2 25626286 missense probably benign 0.04
R8386:Fcna UTSW 2 25626015 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTCACAGTGATCAGGCCTC -3'
(R):5'- CCCATGACCAAGATAATGATGC -3'

Sequencing Primer
(F):5'- ACAGTGATCAGGCCTCTGCTTC -3'
(R):5'- CAAATAGCATGAACTGTGCAGCTTTG -3'
Posted On2020-10-20