Incidental Mutation 'R8417:Olfr358'
ID652981
Institutional Source Beutler Lab
Gene Symbol Olfr358
Ensembl Gene ENSMUSG00000075379
Gene Nameolfactory receptor 358
SynonymsMOR159-4, GA_x6K02T2NLDC-33697309-33696317
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R8417 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location37002163-37009335 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37004646 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 323 (T323S)
Ref Sequence ENSEMBL: ENSMUSP00000150781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100146] [ENSMUST00000213218] [ENSMUST00000216437]
Predicted Effect probably benign
Transcript: ENSMUST00000100146
AA Change: T323S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097724
Gene: ENSMUSG00000075379
AA Change: T323S

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 6.4e-49 PFAM
Pfam:7TM_GPCR_Srsx 35 214 4.7e-7 PFAM
Pfam:7tm_1 41 289 2.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213218
Predicted Effect probably benign
Transcript: ENSMUST00000216437
AA Change: T323S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AB124611 T C 9: 21,529,085 probably null Het
Adamtsl1 G A 4: 86,156,689 D98N possibly damaging Het
Adgrb3 T C 1: 25,488,053 T601A probably benign Het
Ankrd33 C A 15: 101,119,449 Q248K probably benign Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
Casp12 G T 9: 5,352,263 C155F probably benign Het
Clpp T C 17: 56,990,661 V81A probably benign Het
Cyp3a59 A T 5: 146,090,685 I89F possibly damaging Het
Fam227b C A 2: 126,121,062 W178L probably damaging Het
Fcna C A 2: 25,624,851 R332L probably damaging Het
Gdf3 T G 6: 122,606,607 H267P probably damaging Het
Gm4450 G A 3: 98,456,415 T38I probably benign Het
Gm5592 A G 7: 41,288,551 D419G probably benign Het
Gm6882 A G 7: 21,427,295 V216A probably damaging Het
Gsdma3 A G 11: 98,629,777 N78S probably benign Het
Hydin T C 8: 110,569,392 I3579T probably benign Het
Ighmbp2 T C 19: 3,261,590 I942V probably damaging Het
Lamc1 A G 1: 153,230,769 Y1266H probably damaging Het
Lgi3 T C 14: 70,534,806 Y264H probably benign Het
Lmod2 G A 6: 24,603,385 E120K possibly damaging Het
Mbl2 G T 19: 30,239,484 C232F probably damaging Het
Morc1 T C 16: 48,460,740 V214A probably damaging Het
Nlrp4b T A 7: 10,725,953 C827* probably null Het
Olfr1086 A G 2: 86,676,805 F176S probably damaging Het
Pbrm1 T A 14: 31,027,462 H72Q possibly damaging Het
Plekhm2 T C 4: 141,627,825 I944V probably benign Het
Prdm8 A T 5: 98,184,531 D97V probably damaging Het
Preb G A 5: 30,960,117 probably benign Het
Prkcd T C 14: 30,609,251 K56E probably benign Het
Slit3 A T 11: 35,610,611 I391F probably damaging Het
Spata19 A G 9: 27,397,970 S91G probably benign Het
Stag3 A G 5: 138,308,588 T1134A probably benign Het
Tgfbr2 A T 9: 116,110,129 M235K probably benign Het
Tmtc2 A T 10: 105,413,236 I212N probably damaging Het
Tnfrsf26 C T 7: 143,614,902 R133K probably benign Het
Trim43c C A 9: 88,843,138 Q238K probably benign Het
Vcan T C 13: 89,688,743 D2894G probably benign Het
Wisp3 T A 10: 39,151,211 R342* probably null Het
Zeb2 C T 2: 45,022,996 S105N probably damaging Het
Other mutations in Olfr358
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01374:Olfr358 APN 2 37004930 missense probably benign 0.00
IGL01460:Olfr358 APN 2 37004636 missense probably benign 0.06
IGL02066:Olfr358 APN 2 37005309 missense probably damaging 1.00
R0081:Olfr358 UTSW 2 37005450 missense probably damaging 1.00
R0129:Olfr358 UTSW 2 37005045 nonsense probably null
R1441:Olfr358 UTSW 2 37005119 missense possibly damaging 0.82
R1543:Olfr358 UTSW 2 37005127 missense probably damaging 1.00
R1628:Olfr358 UTSW 2 37004726 missense probably damaging 1.00
R1966:Olfr358 UTSW 2 37004948 missense possibly damaging 0.49
R2338:Olfr358 UTSW 2 37005147 missense probably damaging 1.00
R4826:Olfr358 UTSW 2 37005333 missense probably damaging 0.99
R6271:Olfr358 UTSW 2 37005542 missense probably damaging 1.00
R7359:Olfr358 UTSW 2 37005437 missense probably damaging 1.00
R7487:Olfr358 UTSW 2 37004774 missense probably damaging 0.98
R7957:Olfr358 UTSW 2 37004960 missense probably benign
R8413:Olfr358 UTSW 2 37005390 missense probably damaging 1.00
R8427:Olfr358 UTSW 2 37004782 nonsense probably null
R8477:Olfr358 UTSW 2 37005048 missense probably benign 0.40
RF007:Olfr358 UTSW 2 37005174 missense probably damaging 0.99
X0028:Olfr358 UTSW 2 37005599 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGCAAAGGGTTTCAGAATC -3'
(R):5'- CCACATTATGGTTGTGTTGCTC -3'

Sequencing Primer
(F):5'- GCAAAGGGTTTCAGAATCATTTATTC -3'
(R):5'- GTGATTCGCATGTACCTCAAG -3'
Posted On2020-10-20