Incidental Mutation 'R8417:Gm4450'
ID652985
Institutional Source Beutler Lab
Gene Symbol Gm4450
Ensembl Gene ENSMUSG00000090817
Gene Namepredicted gene 4450
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R8417 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location98445675-98457126 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 98456415 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 38 (T38I)
Ref Sequence ENSEMBL: ENSMUSP00000127882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167753] [ENSMUST00000188356]
Predicted Effect probably benign
Transcript: ENSMUST00000167753
AA Change: T38I

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000127882
Gene: ENSMUSG00000090817
AA Change: T38I

DomainStartEndE-ValueType
Pfam:RmlD_sub_bind 4 260 2.4e-9 PFAM
Pfam:KR 5 133 4.7e-8 PFAM
Pfam:Polysacc_synt_2 6 135 1.2e-12 PFAM
Pfam:NmrA 6 147 2.8e-12 PFAM
Pfam:Epimerase 6 249 2.7e-24 PFAM
Pfam:GDP_Man_Dehyd 7 218 8.6e-13 PFAM
Pfam:3Beta_HSD 7 288 2.4e-106 PFAM
Pfam:NAD_binding_4 8 225 5.8e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188356
AA Change: T38I

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000139967
Gene: ENSMUSG00000090817
AA Change: T38I

DomainStartEndE-ValueType
Pfam:RmlD_sub_bind 4 175 1.8e-6 PFAM
Pfam:adh_short 5 133 1.3e-8 PFAM
Pfam:KR 5 133 5.6e-8 PFAM
Pfam:Polysacc_synt_2 6 137 3.1e-11 PFAM
Pfam:NmrA 6 147 2.1e-10 PFAM
Pfam:NAD_binding_10 6 175 4e-12 PFAM
Pfam:Epimerase 6 191 1.6e-22 PFAM
Pfam:3Beta_HSD 7 191 1e-71 PFAM
Pfam:NAD_binding_4 8 191 4e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AB124611 T C 9: 21,529,085 probably null Het
Adamtsl1 G A 4: 86,156,689 D98N possibly damaging Het
Adgrb3 T C 1: 25,488,053 T601A probably benign Het
Ankrd33 C A 15: 101,119,449 Q248K probably benign Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
Casp12 G T 9: 5,352,263 C155F probably benign Het
Clpp T C 17: 56,990,661 V81A probably benign Het
Cyp3a59 A T 5: 146,090,685 I89F possibly damaging Het
Fam227b C A 2: 126,121,062 W178L probably damaging Het
Fcna C A 2: 25,624,851 R332L probably damaging Het
Gdf3 T G 6: 122,606,607 H267P probably damaging Het
Gm5592 A G 7: 41,288,551 D419G probably benign Het
Gm6882 A G 7: 21,427,295 V216A probably damaging Het
Gsdma3 A G 11: 98,629,777 N78S probably benign Het
Hydin T C 8: 110,569,392 I3579T probably benign Het
Ighmbp2 T C 19: 3,261,590 I942V probably damaging Het
Lamc1 A G 1: 153,230,769 Y1266H probably damaging Het
Lgi3 T C 14: 70,534,806 Y264H probably benign Het
Lmod2 G A 6: 24,603,385 E120K possibly damaging Het
Mbl2 G T 19: 30,239,484 C232F probably damaging Het
Morc1 T C 16: 48,460,740 V214A probably damaging Het
Nlrp4b T A 7: 10,725,953 C827* probably null Het
Olfr1086 A G 2: 86,676,805 F176S probably damaging Het
Olfr358 T A 2: 37,004,646 T323S probably benign Het
Pbrm1 T A 14: 31,027,462 H72Q possibly damaging Het
Plekhm2 T C 4: 141,627,825 I944V probably benign Het
Prdm8 A T 5: 98,184,531 D97V probably damaging Het
Preb G A 5: 30,960,117 probably benign Het
Prkcd T C 14: 30,609,251 K56E probably benign Het
Slit3 A T 11: 35,610,611 I391F probably damaging Het
Spata19 A G 9: 27,397,970 S91G probably benign Het
Stag3 A G 5: 138,308,588 T1134A probably benign Het
Tgfbr2 A T 9: 116,110,129 M235K probably benign Het
Tmtc2 A T 10: 105,413,236 I212N probably damaging Het
Tnfrsf26 C T 7: 143,614,902 R133K probably benign Het
Trim43c C A 9: 88,843,138 Q238K probably benign Het
Vcan T C 13: 89,688,743 D2894G probably benign Het
Wisp3 T A 10: 39,151,211 R342* probably null Het
Zeb2 C T 2: 45,022,996 S105N probably damaging Het
Other mutations in Gm4450
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00469:Gm4450 APN 3 98456400 missense probably benign
IGL02004:Gm4450 APN 3 98456419 missense probably damaging 1.00
R0688:Gm4450 UTSW 3 98456394 missense probably benign 0.19
R1301:Gm4450 UTSW 3 98446866 nonsense probably null
R2926:Gm4450 UTSW 3 98450556 splice site probably benign
R4797:Gm4450 UTSW 3 98456431 nonsense probably null
R4915:Gm4450 UTSW 3 98450529 missense probably damaging 0.97
R5796:Gm4450 UTSW 3 98446852 missense probably benign 0.00
R6479:Gm4450 UTSW 3 98446841 missense possibly damaging 0.79
R7085:Gm4450 UTSW 3 98450394 missense probably damaging 1.00
Z1176:Gm4450 UTSW 3 98456455 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACCTGCTCATGACCAATTGTG -3'
(R):5'- GACCCTGTACACATTGAATCAATCC -3'

Sequencing Primer
(F):5'- CCAATTGTGGGTGAGGCC -3'
(R):5'- CACAGGAGTACCTTATATCACATCTG -3'
Posted On2020-10-20