Incidental Mutation 'R8417:Preb'
ID652988
Institutional Source Beutler Lab
Gene Symbol Preb
Ensembl Gene ENSMUSG00000045302
Gene Nameprolactin regulatory element binding
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock #R8417 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location30950853-30960361 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) G to A at 30960117 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074840] [ENSMUST00000202567]
Predicted Effect probably benign
Transcript: ENSMUST00000074840
SMART Domains Protein: ENSMUSP00000074387
Gene: ENSMUSG00000045302

DomainStartEndE-ValueType
low complexity region 24 41 N/A INTRINSIC
low complexity region 99 114 N/A INTRINSIC
WD40 143 182 4.48e-2 SMART
WD40 185 223 4.88e-3 SMART
WD40 289 328 4.42e1 SMART
Blast:WD40 332 382 5e-26 BLAST
transmembrane domain 391 413 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201002
Predicted Effect probably benign
Transcript: ENSMUST00000201821
Predicted Effect probably benign
Transcript: ENSMUST00000202567
SMART Domains Protein: ENSMUSP00000144263
Gene: ENSMUSG00000045302

DomainStartEndE-ValueType
low complexity region 24 41 N/A INTRINSIC
low complexity region 99 114 N/A INTRINSIC
WD40 143 182 4.48e-2 SMART
WD40 185 223 4.88e-3 SMART
WD40 289 328 4.42e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that specifically binds to a Pit1-binding element of the prolactin (PRL) promoter. This protein may act as a transcriptional regulator and is thought to be involved in some of the developmental abnormalities observed in patients with partial trisomy 2p. This gene overlaps the abhydrolase domain containing 1 (ABHD1) gene on the opposite strand. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AB124611 T C 9: 21,529,085 probably null Het
Adamtsl1 G A 4: 86,156,689 D98N possibly damaging Het
Adgrb3 T C 1: 25,488,053 T601A probably benign Het
Ankrd33 C A 15: 101,119,449 Q248K probably benign Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
Casp12 G T 9: 5,352,263 C155F probably benign Het
Clpp T C 17: 56,990,661 V81A probably benign Het
Cyp3a59 A T 5: 146,090,685 I89F possibly damaging Het
Fam227b C A 2: 126,121,062 W178L probably damaging Het
Fcna C A 2: 25,624,851 R332L probably damaging Het
Gdf3 T G 6: 122,606,607 H267P probably damaging Het
Gm4450 G A 3: 98,456,415 T38I probably benign Het
Gm5592 A G 7: 41,288,551 D419G probably benign Het
Gm6882 A G 7: 21,427,295 V216A probably damaging Het
Gsdma3 A G 11: 98,629,777 N78S probably benign Het
Hydin T C 8: 110,569,392 I3579T probably benign Het
Ighmbp2 T C 19: 3,261,590 I942V probably damaging Het
Lamc1 A G 1: 153,230,769 Y1266H probably damaging Het
Lgi3 T C 14: 70,534,806 Y264H probably benign Het
Lmod2 G A 6: 24,603,385 E120K possibly damaging Het
Mbl2 G T 19: 30,239,484 C232F probably damaging Het
Morc1 T C 16: 48,460,740 V214A probably damaging Het
Nlrp4b T A 7: 10,725,953 C827* probably null Het
Olfr1086 A G 2: 86,676,805 F176S probably damaging Het
Olfr358 T A 2: 37,004,646 T323S probably benign Het
Pbrm1 T A 14: 31,027,462 H72Q possibly damaging Het
Plekhm2 T C 4: 141,627,825 I944V probably benign Het
Prdm8 A T 5: 98,184,531 D97V probably damaging Het
Prkcd T C 14: 30,609,251 K56E probably benign Het
Slit3 A T 11: 35,610,611 I391F probably damaging Het
Spata19 A G 9: 27,397,970 S91G probably benign Het
Stag3 A G 5: 138,308,588 T1134A probably benign Het
Tgfbr2 A T 9: 116,110,129 M235K probably benign Het
Tmtc2 A T 10: 105,413,236 I212N probably damaging Het
Tnfrsf26 C T 7: 143,614,902 R133K probably benign Het
Trim43c C A 9: 88,843,138 Q238K probably benign Het
Vcan T C 13: 89,688,743 D2894G probably benign Het
Wisp3 T A 10: 39,151,211 R342* probably null Het
Zeb2 C T 2: 45,022,996 S105N probably damaging Het
Other mutations in Preb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Preb APN 5 30955964 missense probably damaging 1.00
IGL01344:Preb APN 5 30956044 missense probably damaging 0.99
IGL03383:Preb APN 5 30958321 missense probably damaging 1.00
R1520:Preb UTSW 5 30958524 missense probably benign 0.14
R1987:Preb UTSW 5 30958813 missense probably damaging 1.00
R2327:Preb UTSW 5 30958505 missense probably damaging 0.99
R5607:Preb UTSW 5 30959963 splice site probably benign
R5769:Preb UTSW 5 30958291 nonsense probably null
R5831:Preb UTSW 5 30958864 missense probably benign
R6271:Preb UTSW 5 30958051 missense probably damaging 0.99
R6539:Preb UTSW 5 30956076 missense probably benign 0.03
R7575:Preb UTSW 5 30958495 missense probably damaging 1.00
R7873:Preb UTSW 5 30958765 missense probably benign 0.05
R8515:Preb UTSW 5 30959378 missense probably damaging 1.00
X0065:Preb UTSW 5 30958936 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TATAACCTGTTCTCAGTGGCC -3'
(R):5'- TCATCGTCATTCGGGGCTAG -3'

Sequencing Primer
(F):5'- TGTTCTCAGTGGCCCTGCG -3'
(R):5'- GCACTGAACGCCTGCAAG -3'
Posted On2020-10-20