Incidental Mutation 'R8417:Prdm8'
ID652989
Institutional Source Beutler Lab
Gene Symbol Prdm8
Ensembl Gene ENSMUSG00000035456
Gene NamePR domain containing 8
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.576) question?
Stock #R8417 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location98167198-98188991 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 98184531 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 97 (D97V)
Ref Sequence ENSEMBL: ENSMUSP00000108583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112959] [ENSMUST00000210477]
Predicted Effect probably damaging
Transcript: ENSMUST00000112959
AA Change: D97V

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108583
Gene: ENSMUSG00000035456
AA Change: D97V

DomainStartEndE-ValueType
SET 20 137 1.55e0 SMART
ZnF_C2H2 154 182 2.37e2 SMART
low complexity region 192 219 N/A INTRINSIC
low complexity region 275 291 N/A INTRINSIC
low complexity region 315 332 N/A INTRINSIC
low complexity region 397 427 N/A INTRINSIC
low complexity region 471 492 N/A INTRINSIC
low complexity region 556 570 N/A INTRINSIC
low complexity region 599 621 N/A INTRINSIC
ZnF_C2H2 624 646 9.22e0 SMART
ZnF_C2H2 665 687 1.2e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000210477
AA Change: D97V

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a conserved family of histone methyltransferases that predominantly act as negative regulators of transcription. The encoded protein contains an N-terminal Su(var)3-9, Enhancer-of-zeste, and Trithorax (SET) domain and a double zinc-finger domain. Knockout of this gene in mouse results in mistargeting by neurons of the dorsal telencephalon, abnormal itch-like behavior, and impaired differentiation of rod bipolar cells. In humans, the protein has been shown to interact with the phosphatase laforin and the ubiquitin ligase malin, which regulate glycogen construction in the cytoplasm. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature termination of corticopsinal motor neuron axons, absent corpus callosum and hippocampal commissure, excessive scratching, skin lesions, and contraction of hindpaws resulting a handstand phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AB124611 T C 9: 21,529,085 probably null Het
Adamtsl1 G A 4: 86,156,689 D98N possibly damaging Het
Adgrb3 T C 1: 25,488,053 T601A probably benign Het
Ankrd33 C A 15: 101,119,449 Q248K probably benign Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
Casp12 G T 9: 5,352,263 C155F probably benign Het
Clpp T C 17: 56,990,661 V81A probably benign Het
Cyp3a59 A T 5: 146,090,685 I89F possibly damaging Het
Fam227b C A 2: 126,121,062 W178L probably damaging Het
Fcna C A 2: 25,624,851 R332L probably damaging Het
Gdf3 T G 6: 122,606,607 H267P probably damaging Het
Gm4450 G A 3: 98,456,415 T38I probably benign Het
Gm5592 A G 7: 41,288,551 D419G probably benign Het
Gm6882 A G 7: 21,427,295 V216A probably damaging Het
Gsdma3 A G 11: 98,629,777 N78S probably benign Het
Hydin T C 8: 110,569,392 I3579T probably benign Het
Ighmbp2 T C 19: 3,261,590 I942V probably damaging Het
Lamc1 A G 1: 153,230,769 Y1266H probably damaging Het
Lgi3 T C 14: 70,534,806 Y264H probably benign Het
Lmod2 G A 6: 24,603,385 E120K possibly damaging Het
Mbl2 G T 19: 30,239,484 C232F probably damaging Het
Morc1 T C 16: 48,460,740 V214A probably damaging Het
Nlrp4b T A 7: 10,725,953 C827* probably null Het
Olfr1086 A G 2: 86,676,805 F176S probably damaging Het
Olfr358 T A 2: 37,004,646 T323S probably benign Het
Pbrm1 T A 14: 31,027,462 H72Q possibly damaging Het
Plekhm2 T C 4: 141,627,825 I944V probably benign Het
Preb G A 5: 30,960,117 probably benign Het
Prkcd T C 14: 30,609,251 K56E probably benign Het
Slit3 A T 11: 35,610,611 I391F probably damaging Het
Spata19 A G 9: 27,397,970 S91G probably benign Het
Stag3 A G 5: 138,308,588 T1134A probably benign Het
Tgfbr2 A T 9: 116,110,129 M235K probably benign Het
Tmtc2 A T 10: 105,413,236 I212N probably damaging Het
Tnfrsf26 C T 7: 143,614,902 R133K probably benign Het
Trim43c C A 9: 88,843,138 Q238K probably benign Het
Vcan T C 13: 89,688,743 D2894G probably benign Het
Wisp3 T A 10: 39,151,211 R342* probably null Het
Zeb2 C T 2: 45,022,996 S105N probably damaging Het
Other mutations in Prdm8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Prdm8 APN 5 98183343 missense probably damaging 1.00
IGL02208:Prdm8 APN 5 98183465 missense possibly damaging 0.93
IGL02676:Prdm8 APN 5 98186559 missense probably damaging 1.00
R0060:Prdm8 UTSW 5 98185260 missense probably benign 0.19
R0063:Prdm8 UTSW 5 98184594 missense probably damaging 0.98
R0063:Prdm8 UTSW 5 98184594 missense probably damaging 0.98
R0630:Prdm8 UTSW 5 98184521 missense probably damaging 1.00
R1099:Prdm8 UTSW 5 98183502 missense probably damaging 0.99
R4373:Prdm8 UTSW 5 98186508 missense probably damaging 1.00
R4643:Prdm8 UTSW 5 98184587 missense possibly damaging 0.61
R4936:Prdm8 UTSW 5 98185022 critical splice acceptor site probably null
R4936:Prdm8 UTSW 5 98185023 critical splice acceptor site probably null
R5033:Prdm8 UTSW 5 98185212 nonsense probably null
R5495:Prdm8 UTSW 5 98185306 missense possibly damaging 0.62
R6307:Prdm8 UTSW 5 98185303 missense possibly damaging 0.84
R6562:Prdm8 UTSW 5 98183343 missense possibly damaging 0.82
R6970:Prdm8 UTSW 5 98184612 missense probably damaging 0.99
R7343:Prdm8 UTSW 5 98184516 missense probably damaging 1.00
R8421:Prdm8 UTSW 5 98185963 missense probably damaging 1.00
Z1177:Prdm8 UTSW 5 98184632 missense probably damaging 1.00
Z1177:Prdm8 UTSW 5 98186551 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGACCACAAATGCAGGGATG -3'
(R):5'- GAGCCAACCTACCGTTCATTTTG -3'

Sequencing Primer
(F):5'- ATGCAGTTCGACTTTGGTCAAC -3'
(R):5'- ACCGTTCATTTTGTGAGCTCTAGAC -3'
Posted On2020-10-20