Mutagenetix > Incidental Mutations

Incidental Mutation 'R8417:Stag3'

652990

Institutional Source

Beutler Lab

Gene Symbol

Stag3

Ensembl Gene

ENSMUSG00000036928

Gene Name

stromal antigen 3

Synonyms

SA-2, stromalin 3

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_016964.2; MGI:1355311

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8417 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

138280240-138312393 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 138308588 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1134 (T1134A)

Ref Sequence

ENSEMBL: ENSMUSP00000040945 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048028] [ENSMUST00000160849] [ENSMUST00000162245]

Predicted Effect

probably benign
Transcript: ENSMUST00000048028
AA Change: T1134A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000040945
Gene: ENSMUSG00000036928
AA Change: T1134A

Domain	Start	End	E-Value	Type
low complexity region	6	26	N/A	INTRINSIC
low complexity region	75	90	N/A	INTRINSIC
Pfam:STAG	188	301	3.1e-38	PFAM
low complexity region	633	653	N/A	INTRINSIC
low complexity region	1099	1114	N/A	INTRINSIC
low complexity region	1141	1151	N/A	INTRINSIC
low complexity region	1190	1208	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000159189

Predicted Effect

probably benign
Transcript: ENSMUST00000160849
AA Change: T115A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000125376
Gene: ENSMUSG00000036928
AA Change: T115A

Domain	Start	End	E-Value	Type
low complexity region	80	95	N/A	INTRINSIC
low complexity region	122	132	N/A	INTRINSIC
low complexity region	138	152	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000162245
AA Change: T1134A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000125523
Gene: ENSMUSG00000036928
AA Change: T1134A

Domain	Start	End	E-Value	Type
low complexity region	6	26	N/A	INTRINSIC
low complexity region	75	90	N/A	INTRINSIC
Pfam:STAG	185	304	4e-50	PFAM
low complexity region	633	653	N/A	INTRINSIC
low complexity region	1099	1114	N/A	INTRINSIC
low complexity region	1141	1151	N/A	INTRINSIC
low complexity region	1190	1208	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

Strain: 5287255
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is expressed in the nucleus and is a subunit of the cohesin complex which regulates the cohesion of sister chromatids during cell division. A mutation in this gene is associated with premature ovarian failure. Alternate splicing results in multiple transcript variants encoding distinct isoforms. This gene has multiple pseudogenes. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit azoospermia and lack oocytes. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted(2) Gene trapped(1) Transgenic(1)

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AB124611	T	C	9: 21,529,085		probably null	Het
Adamtsl1	G	A	4: 86,156,689	D98N	possibly damaging	Het
Adgrb3	T	C	1: 25,488,053	T601A	probably benign	Het
Ankrd33	C	A	15: 101,119,449	Q248K	probably benign	Het
Bsn	G	A	9: 108,111,452	A2367V	probably benign	Het
Casp12	G	T	9: 5,352,263	C155F	probably benign	Het
Clpp	T	C	17: 56,990,661	V81A	probably benign	Het
Cyp3a59	A	T	5: 146,090,685	I89F	possibly damaging	Het
Fam227b	C	A	2: 126,121,062	W178L	probably damaging	Het
Fcna	C	A	2: 25,624,851	R332L	probably damaging	Het
Gdf3	T	G	6: 122,606,607	H267P	probably damaging	Het
Gm4450	G	A	3: 98,456,415	T38I	probably benign	Het
Gm5592	A	G	7: 41,288,551	D419G	probably benign	Het
Gm6882	A	G	7: 21,427,295	V216A	probably damaging	Het
Gsdma3	A	G	11: 98,629,777	N78S	probably benign	Het
Hydin	T	C	8: 110,569,392	I3579T	probably benign	Het
Ighmbp2	T	C	19: 3,261,590	I942V	probably damaging	Het
Lamc1	A	G	1: 153,230,769	Y1266H	probably damaging	Het
Lgi3	T	C	14: 70,534,806	Y264H	probably benign	Het
Lmod2	G	A	6: 24,603,385	E120K	possibly damaging	Het
Mbl2	G	T	19: 30,239,484	C232F	probably damaging	Het
Morc1	T	C	16: 48,460,740	V214A	probably damaging	Het
Nlrp4b	T	A	7: 10,725,953	C827*	probably null	Het
Olfr1086	A	G	2: 86,676,805	F176S	probably damaging	Het
Olfr358	T	A	2: 37,004,646	T323S	probably benign	Het
Pbrm1	T	A	14: 31,027,462	H72Q	possibly damaging	Het
Plekhm2	T	C	4: 141,627,825	I944V	probably benign	Het
Prdm8	A	T	5: 98,184,531	D97V	probably damaging	Het
Preb	G	A	5: 30,960,117		probably benign	Het
Prkcd	T	C	14: 30,609,251	K56E	probably benign	Het
Slit3	A	T	11: 35,610,611	I391F	probably damaging	Het
Spata19	A	G	9: 27,397,970	S91G	probably benign	Het
Tgfbr2	A	T	9: 116,110,129	M235K	probably benign	Het
Tmtc2	A	T	10: 105,413,236	I212N	probably damaging	Het
Tnfrsf26	C	T	7: 143,614,902	R133K	probably benign	Het
Trim43c	C	A	9: 88,843,138	Q238K	probably benign	Het
Vcan	T	C	13: 89,688,743	D2894G	probably benign	Het
Wisp3	T	A	10: 39,151,211	R342*	probably null	Het
Zeb2	C	T	2: 45,022,996	S105N	probably damaging	Het

Other mutations in Stag3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Stag3	APN	5	138299138	missense	probably damaging	1.00
IGL00336:Stag3	APN	5	138297659	missense	probably benign	0.42
IGL00514:Stag3	APN	5	138300135	missense	probably damaging	1.00
IGL00961:Stag3	APN	5	138298349	missense	probably benign	0.01
IGL01923:Stag3	APN	5	138289230	missense	probably damaging	1.00
IGL02252:Stag3	APN	5	138302548	missense	probably damaging	1.00
IGL02424:Stag3	APN	5	138281985	nonsense	probably null
IGL02424:Stag3	APN	5	138291366	missense	probably damaging	1.00
IGL02869:Stag3	APN	5	138282693	missense	probably damaging	0.96
thor	UTSW	5	138301036	critical splice donor site	probably null
R0016:Stag3	UTSW	5	138291381	missense	possibly damaging	0.50
R0038:Stag3	UTSW	5	138301036	critical splice donor site	probably null
R0038:Stag3	UTSW	5	138301036	critical splice donor site	probably null
R0046:Stag3	UTSW	5	138283023	splice site	probably benign
R0046:Stag3	UTSW	5	138283023	splice site	probably benign
R1455:Stag3	UTSW	5	138311735	missense	probably benign	0.00
R1512:Stag3	UTSW	5	138297985	missense	probably benign	0.32
R1530:Stag3	UTSW	5	138297412	missense	probably damaging	0.99
R1608:Stag3	UTSW	5	138298639	splice site	probably null
R1736:Stag3	UTSW	5	138304509	splice site	probably benign
R1969:Stag3	UTSW	5	138300138	missense	probably damaging	0.99
R2034:Stag3	UTSW	5	138298001	missense	possibly damaging	0.82
R2214:Stag3	UTSW	5	138301266	missense	possibly damaging	0.92
R2281:Stag3	UTSW	5	138298284	missense	probably damaging	1.00
R2411:Stag3	UTSW	5	138283028	splice site	probably benign
R3792:Stag3	UTSW	5	138298349	missense	probably benign	0.01
R3887:Stag3	UTSW	5	138298839	missense	probably damaging	0.99
R4255:Stag3	UTSW	5	138290881	missense	probably damaging	0.98
R4777:Stag3	UTSW	5	138309199	unclassified	probably benign
R4842:Stag3	UTSW	5	138309365	splice site	probably null
R4854:Stag3	UTSW	5	138296694	splice site	probably null
R5045:Stag3	UTSW	5	138304478	missense	probably damaging	1.00
R5631:Stag3	UTSW	5	138295877	missense	probably damaging	0.96
R5729:Stag3	UTSW	5	138290223	missense	possibly damaging	0.76
R5894:Stag3	UTSW	5	138298838	missense	probably damaging	0.99
R6004:Stag3	UTSW	5	138289206	missense	probably damaging	1.00
R6172:Stag3	UTSW	5	138299843	missense	probably benign	0.41
R6503:Stag3	UTSW	5	138304420	missense	probably damaging	0.96
R6545:Stag3	UTSW	5	138298352	missense	possibly damaging	0.84
R6736:Stag3	UTSW	5	138301499	missense	probably damaging	0.98
R6861:Stag3	UTSW	5	138304707	missense	possibly damaging	0.55
R7012:Stag3	UTSW	5	138297609	splice site	probably null
R7358:Stag3	UTSW	5	138301508	missense	probably damaging	1.00
R7378:Stag3	UTSW	5	138281960	missense	probably benign	0.00
R7392:Stag3	UTSW	5	138291366	missense	probably damaging	1.00
R7395:Stag3	UTSW	5	138281945	missense	probably benign	0.33
R7818:Stag3	UTSW	5	138301443	missense	probably benign	0.00
R8017:Stag3	UTSW	5	138301203	missense	possibly damaging	0.80
R8019:Stag3	UTSW	5	138301203	missense	possibly damaging	0.80
R8076:Stag3	UTSW	5	138283142	missense	probably damaging	0.96
R8393:Stag3	UTSW	5	138296755	missense	probably damaging	0.98
R8405:Stag3	UTSW	5	138304652	missense	probably damaging	0.99
Z1177:Stag3	UTSW	5	138301292	missense	possibly damaging	0.65

Predicted Primers

PCR Primer
(F):5'- GGGACAGGTTTATAAAAGTAGCTCTG -3'
(R):5'- TCAACCTCTGGGTGCCTAAG -3'

Sequencing Primer
(F):5'- AAGCCTTCAGCTGAACAG -3'
(R):5'- AACCTCTGGGTGCCTAAGAGTTG -3'

Posted On

2020-10-20