Incidental Mutation 'R8417:Gdf3'
ID652993
Institutional Source Beutler Lab
Gene Symbol Gdf3
Ensembl Gene ENSMUSG00000030117
Gene Namegrowth differentiation factor 3
SynonymsGdf-3, Vgr-2, ecat9, Vgr2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8417 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location122605403-122610087 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 122606607 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Proline at position 267 (H267P)
Ref Sequence ENSEMBL: ENSMUSP00000032211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032211] [ENSMUST00000112585] [ENSMUST00000112586] [ENSMUST00000147760] [ENSMUST00000203197] [ENSMUST00000203309]
Predicted Effect probably damaging
Transcript: ENSMUST00000032211
AA Change: H267P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032211
Gene: ENSMUSG00000030117
AA Change: H267P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 57 68 N/A INTRINSIC
Pfam:TGFb_propeptide 91 222 3.1e-7 PFAM
TGFB 266 366 6.86e-67 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112585
SMART Domains Protein: ENSMUSP00000108204
Gene: ENSMUSG00000040613

DomainStartEndE-ValueType
Pfam:APOBEC_N 15 181 3.6e-38 PFAM
Pfam:APOBEC_C 124 178 9.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112586
SMART Domains Protein: ENSMUSP00000108205
Gene: ENSMUSG00000040613

DomainStartEndE-ValueType
Pfam:APOBEC_N 15 181 3.6e-38 PFAM
Pfam:APOBEC_C 124 178 9.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147760
Predicted Effect probably benign
Transcript: ENSMUST00000203197
Predicted Effect probably benign
Transcript: ENSMUST00000203309
SMART Domains Protein: ENSMUSP00000145417
Gene: ENSMUSG00000040613

DomainStartEndE-ValueType
Pfam:APOBEC_N 21 121 1.6e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein is important in embryogenesis and likely plays a role ocular and skeletal development. Mice lacking a functional copy of this gene exhibit defects in early embryonic development resulting in embryonic lethality. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit prenatal lethality and resistance to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AB124611 T C 9: 21,529,085 probably null Het
Adamtsl1 G A 4: 86,156,689 D98N possibly damaging Het
Adgrb3 T C 1: 25,488,053 T601A probably benign Het
Ankrd33 C A 15: 101,119,449 Q248K probably benign Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
Casp12 G T 9: 5,352,263 C155F probably benign Het
Clpp T C 17: 56,990,661 V81A probably benign Het
Cyp3a59 A T 5: 146,090,685 I89F possibly damaging Het
Fam227b C A 2: 126,121,062 W178L probably damaging Het
Fcna C A 2: 25,624,851 R332L probably damaging Het
Gm4450 G A 3: 98,456,415 T38I probably benign Het
Gm5592 A G 7: 41,288,551 D419G probably benign Het
Gm6882 A G 7: 21,427,295 V216A probably damaging Het
Gsdma3 A G 11: 98,629,777 N78S probably benign Het
Hydin T C 8: 110,569,392 I3579T probably benign Het
Ighmbp2 T C 19: 3,261,590 I942V probably damaging Het
Lamc1 A G 1: 153,230,769 Y1266H probably damaging Het
Lgi3 T C 14: 70,534,806 Y264H probably benign Het
Lmod2 G A 6: 24,603,385 E120K possibly damaging Het
Mbl2 G T 19: 30,239,484 C232F probably damaging Het
Morc1 T C 16: 48,460,740 V214A probably damaging Het
Nlrp4b T A 7: 10,725,953 C827* probably null Het
Olfr1086 A G 2: 86,676,805 F176S probably damaging Het
Olfr358 T A 2: 37,004,646 T323S probably benign Het
Pbrm1 T A 14: 31,027,462 H72Q possibly damaging Het
Plekhm2 T C 4: 141,627,825 I944V probably benign Het
Prdm8 A T 5: 98,184,531 D97V probably damaging Het
Preb G A 5: 30,960,117 probably benign Het
Prkcd T C 14: 30,609,251 K56E probably benign Het
Slit3 A T 11: 35,610,611 I391F probably damaging Het
Spata19 A G 9: 27,397,970 S91G probably benign Het
Stag3 A G 5: 138,308,588 T1134A probably benign Het
Tgfbr2 A T 9: 116,110,129 M235K probably benign Het
Tmtc2 A T 10: 105,413,236 I212N probably damaging Het
Tnfrsf26 C T 7: 143,614,902 R133K probably benign Het
Trim43c C A 9: 88,843,138 Q238K probably benign Het
Vcan T C 13: 89,688,743 D2894G probably benign Het
Wisp3 T A 10: 39,151,211 R342* probably null Het
Zeb2 C T 2: 45,022,996 S105N probably damaging Het
Other mutations in Gdf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Gdf3 APN 6 122607126 missense probably damaging 1.00
R0396:Gdf3 UTSW 6 122607135 missense probably damaging 1.00
R1503:Gdf3 UTSW 6 122606337 missense probably damaging 1.00
R1553:Gdf3 UTSW 6 122609765 missense probably benign 0.02
R1762:Gdf3 UTSW 6 122606407 missense possibly damaging 0.71
R1824:Gdf3 UTSW 6 122609962 missense probably benign 0.33
R2696:Gdf3 UTSW 6 122606900 missense probably benign
R3963:Gdf3 UTSW 6 122606758 missense probably benign 0.00
R4113:Gdf3 UTSW 6 122607057 missense probably damaging 0.96
R5090:Gdf3 UTSW 6 122609754 missense probably benign 0.12
R5257:Gdf3 UTSW 6 122606386 missense probably damaging 1.00
R7132:Gdf3 UTSW 6 122606324 missense probably damaging 1.00
R7615:Gdf3 UTSW 6 122606916 missense probably benign 0.00
R8171:Gdf3 UTSW 6 122609903 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCAGCCATATGCATCAGAGC -3'
(R):5'- ATTGGAGCAGCAACCGACTG -3'

Sequencing Primer
(F):5'- TATGCATCAGAGCCTGCATG -3'
(R):5'- TTCTGGTCAAAGAGGACAGATACTCC -3'
Posted On2020-10-20