Incidental Mutation 'R8417:Tnfrsf26'
ID652997
Institutional Source Beutler Lab
Gene Symbol Tnfrsf26
Ensembl Gene ENSMUSG00000045362
Gene Nametumor necrosis factor receptor superfamily, member 26
SynonymsTnfrh3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R8417 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location143607659-143628722 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 143614902 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Lysine at position 133 (R133K)
Ref Sequence ENSEMBL: ENSMUSP00000054938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055723] [ENSMUST00000208124]
Predicted Effect probably benign
Transcript: ENSMUST00000055723
AA Change: R133K

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000054938
Gene: ENSMUSG00000045362
AA Change: R133K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
TNFR 27 61 1.95e0 SMART
TNFR 64 103 6.89e-8 SMART
TNFR 105 143 1.1e-6 SMART
transmembrane domain 163 185 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208124
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AB124611 T C 9: 21,529,085 probably null Het
Adamtsl1 G A 4: 86,156,689 D98N possibly damaging Het
Adgrb3 T C 1: 25,488,053 T601A probably benign Het
Ankrd33 C A 15: 101,119,449 Q248K probably benign Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
Casp12 G T 9: 5,352,263 C155F probably benign Het
Clpp T C 17: 56,990,661 V81A probably benign Het
Cyp3a59 A T 5: 146,090,685 I89F possibly damaging Het
Fam227b C A 2: 126,121,062 W178L probably damaging Het
Fcna C A 2: 25,624,851 R332L probably damaging Het
Gdf3 T G 6: 122,606,607 H267P probably damaging Het
Gm4450 G A 3: 98,456,415 T38I probably benign Het
Gm5592 A G 7: 41,288,551 D419G probably benign Het
Gm6882 A G 7: 21,427,295 V216A probably damaging Het
Gsdma3 A G 11: 98,629,777 N78S probably benign Het
Hydin T C 8: 110,569,392 I3579T probably benign Het
Ighmbp2 T C 19: 3,261,590 I942V probably damaging Het
Lamc1 A G 1: 153,230,769 Y1266H probably damaging Het
Lgi3 T C 14: 70,534,806 Y264H probably benign Het
Lmod2 G A 6: 24,603,385 E120K possibly damaging Het
Mbl2 G T 19: 30,239,484 C232F probably damaging Het
Morc1 T C 16: 48,460,740 V214A probably damaging Het
Nlrp4b T A 7: 10,725,953 C827* probably null Het
Olfr1086 A G 2: 86,676,805 F176S probably damaging Het
Olfr358 T A 2: 37,004,646 T323S probably benign Het
Pbrm1 T A 14: 31,027,462 H72Q possibly damaging Het
Plekhm2 T C 4: 141,627,825 I944V probably benign Het
Prdm8 A T 5: 98,184,531 D97V probably damaging Het
Preb G A 5: 30,960,117 probably benign Het
Prkcd T C 14: 30,609,251 K56E probably benign Het
Slit3 A T 11: 35,610,611 I391F probably damaging Het
Spata19 A G 9: 27,397,970 S91G probably benign Het
Stag3 A G 5: 138,308,588 T1134A probably benign Het
Tgfbr2 A T 9: 116,110,129 M235K probably benign Het
Tmtc2 A T 10: 105,413,236 I212N probably damaging Het
Trim43c C A 9: 88,843,138 Q238K probably benign Het
Vcan T C 13: 89,688,743 D2894G probably benign Het
Wisp3 T A 10: 39,151,211 R342* probably null Het
Zeb2 C T 2: 45,022,996 S105N probably damaging Het
Other mutations in Tnfrsf26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03053:Tnfrsf26 APN 7 143614860 missense possibly damaging 0.83
R1120:Tnfrsf26 UTSW 7 143617914 missense probably damaging 1.00
R1465:Tnfrsf26 UTSW 7 143617931 missense probably damaging 1.00
R1465:Tnfrsf26 UTSW 7 143617931 missense probably damaging 1.00
R1957:Tnfrsf26 UTSW 7 143617923 missense probably damaging 1.00
R2132:Tnfrsf26 UTSW 7 143617840 critical splice donor site probably null
R6183:Tnfrsf26 UTSW 7 143611757 missense probably damaging 0.99
R6913:Tnfrsf26 UTSW 7 143618389 nonsense probably null
R7414:Tnfrsf26 UTSW 7 143614905 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCAATGCTACCTTCTCGAC -3'
(R):5'- CCCCTAAACTCTAATCTCCTCAGAGTG -3'

Sequencing Primer
(F):5'- TTGTTGGGATAAAACACCATGGCC -3'
(R):5'- CCTCAGAGTGCTTTTGCCAGAATG -3'
Posted On2020-10-20