Incidental Mutation 'R8417:Casp12'
ID652999
Institutional Source Beutler Lab
Gene Symbol Casp12
Ensembl Gene ENSMUSG00000025887
Gene Namecaspase 12
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8417 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location5345430-5373032 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 5352263 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 155 (C155F)
Ref Sequence ENSEMBL: ENSMUSP00000027009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027009] [ENSMUST00000151332] [ENSMUST00000151788]
Predicted Effect probably benign
Transcript: ENSMUST00000027009
AA Change: C155F

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000027009
Gene: ENSMUSG00000025887
AA Change: C155F

DomainStartEndE-ValueType
CARD 1 83 3.54e-2 SMART
CASc 165 417 2.59e-132 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151332
AA Change: C85F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000122201
Gene: ENSMUSG00000025887
AA Change: C85F

DomainStartEndE-ValueType
CASc 95 347 2.59e-132 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151788
AA Change: C155F

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000121565
Gene: ENSMUSG00000025887
AA Change: C155F

DomainStartEndE-ValueType
CARD 1 83 3.54e-2 SMART
Pfam:Peptidase_C14 176 230 1.1e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mice for some mutations of this gene display resistance to ER stress-induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AB124611 T C 9: 21,529,085 probably null Het
Adamtsl1 G A 4: 86,156,689 D98N possibly damaging Het
Adgrb3 T C 1: 25,488,053 T601A probably benign Het
Ankrd33 C A 15: 101,119,449 Q248K probably benign Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
Clpp T C 17: 56,990,661 V81A probably benign Het
Cyp3a59 A T 5: 146,090,685 I89F possibly damaging Het
Fam227b C A 2: 126,121,062 W178L probably damaging Het
Fcna C A 2: 25,624,851 R332L probably damaging Het
Gdf3 T G 6: 122,606,607 H267P probably damaging Het
Gm4450 G A 3: 98,456,415 T38I probably benign Het
Gm5592 A G 7: 41,288,551 D419G probably benign Het
Gm6882 A G 7: 21,427,295 V216A probably damaging Het
Gsdma3 A G 11: 98,629,777 N78S probably benign Het
Hydin T C 8: 110,569,392 I3579T probably benign Het
Ighmbp2 T C 19: 3,261,590 I942V probably damaging Het
Lamc1 A G 1: 153,230,769 Y1266H probably damaging Het
Lgi3 T C 14: 70,534,806 Y264H probably benign Het
Lmod2 G A 6: 24,603,385 E120K possibly damaging Het
Mbl2 G T 19: 30,239,484 C232F probably damaging Het
Morc1 T C 16: 48,460,740 V214A probably damaging Het
Nlrp4b T A 7: 10,725,953 C827* probably null Het
Olfr1086 A G 2: 86,676,805 F176S probably damaging Het
Olfr358 T A 2: 37,004,646 T323S probably benign Het
Pbrm1 T A 14: 31,027,462 H72Q possibly damaging Het
Plekhm2 T C 4: 141,627,825 I944V probably benign Het
Prdm8 A T 5: 98,184,531 D97V probably damaging Het
Preb G A 5: 30,960,117 probably benign Het
Prkcd T C 14: 30,609,251 K56E probably benign Het
Slit3 A T 11: 35,610,611 I391F probably damaging Het
Spata19 A G 9: 27,397,970 S91G probably benign Het
Stag3 A G 5: 138,308,588 T1134A probably benign Het
Tgfbr2 A T 9: 116,110,129 M235K probably benign Het
Tmtc2 A T 10: 105,413,236 I212N probably damaging Het
Tnfrsf26 C T 7: 143,614,902 R133K probably benign Het
Trim43c C A 9: 88,843,138 Q238K probably benign Het
Vcan T C 13: 89,688,743 D2894G probably benign Het
Wisp3 T A 10: 39,151,211 R342* probably null Het
Zeb2 C T 2: 45,022,996 S105N probably damaging Het
Other mutations in Casp12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00667:Casp12 APN 9 5352665 splice site probably null
IGL00717:Casp12 APN 9 5352702 missense probably damaging 1.00
IGL02326:Casp12 APN 9 5358317 missense possibly damaging 0.92
R0016:Casp12 UTSW 9 5352844 missense probably null 0.01
R0016:Casp12 UTSW 9 5352844 missense probably null 0.01
R0329:Casp12 UTSW 9 5345534 splice site probably benign
R0392:Casp12 UTSW 9 5348973 splice site probably benign
R0584:Casp12 UTSW 9 5352268 missense probably null 0.00
R0609:Casp12 UTSW 9 5346554 missense probably damaging 1.00
R1099:Casp12 UTSW 9 5352204 missense probably benign
R1951:Casp12 UTSW 9 5348959 critical splice donor site probably null
R2034:Casp12 UTSW 9 5346491 missense probably damaging 0.97
R4208:Casp12 UTSW 9 5346629 missense probably damaging 1.00
R4558:Casp12 UTSW 9 5352742 missense probably damaging 1.00
R4592:Casp12 UTSW 9 5352923 intron probably benign
R4597:Casp12 UTSW 9 5348941 missense possibly damaging 0.55
R4913:Casp12 UTSW 9 5358726 missense probably damaging 1.00
R4965:Casp12 UTSW 9 5352250 missense probably benign 0.00
R5495:Casp12 UTSW 9 5353797 missense possibly damaging 0.95
R5777:Casp12 UTSW 9 5354548 missense probably benign 0.01
R6641:Casp12 UTSW 9 5354612 missense probably benign
R7159:Casp12 UTSW 9 5353763 missense possibly damaging 0.89
R7320:Casp12 UTSW 9 5348897 critical splice acceptor site probably null
R7349:Casp12 UTSW 9 5345527 critical splice donor site probably null
R7636:Casp12 UTSW 9 5358344 missense probably benign 0.15
R7695:Casp12 UTSW 9 5353641 missense probably damaging 0.99
R7819:Casp12 UTSW 9 5352805 missense probably damaging 1.00
R8071:Casp12 UTSW 9 5346647 missense probably damaging 1.00
R8514:Casp12 UTSW 9 5352735 missense probably damaging 1.00
Z1088:Casp12 UTSW 9 5354582 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TCTGAGGAGCACCAATGAGC -3'
(R):5'- ACTGAAAACATATATTGGGGCCTG -3'

Sequencing Primer
(F):5'- GCACTCTAAAATGATGAACTCGG -3'
(R):5'- ACTAGTGACATGACTTGGATTTTG -3'
Posted On2020-10-20