Incidental Mutation 'R8417:Tgfbr2'
ID653004
Institutional Source Beutler Lab
Gene Symbol Tgfbr2
Ensembl Gene ENSMUSG00000032440
Gene Nametransforming growth factor, beta receptor II
SynonymsTbetaR-II, TBR-II, TbetaRII, 1110020H15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8417 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location116084293-116175360 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 116110129 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 235 (M235K)
Ref Sequence ENSEMBL: ENSMUSP00000062333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035014] [ENSMUST00000061101]
Predicted Effect probably benign
Transcript: ENSMUST00000035014
AA Change: M210K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000035014
Gene: ENSMUSG00000032440
AA Change: M210K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ecTbetaR2 47 165 1.8e-55 PFAM
Pfam:Pkinase 244 538 9.9e-52 PFAM
Pfam:Pkinase_Tyr 244 538 2.9e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061101
AA Change: M235K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000062333
Gene: ENSMUSG00000032440
AA Change: M235K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ecTbetaR2 74 184 4.6e-45 PFAM
transmembrane domain 189 211 N/A INTRINSIC
Pfam:Pkinase 269 563 2.7e-36 PFAM
Pfam:Pkinase_Tyr 269 563 5e-37 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ser/Thr protein kinase family and the TGFB receptor subfamily. The encoded protein is a transmembrane protein that has a protein kinase domain, forms a heterodimeric complex with another receptor protein, and binds TGF-beta. This receptor/ligand complex phosphorylates proteins, which then enter the nucleus and regulate the transcription of a subset of genes related to cell proliferation. Mutations in this gene have been associated with Marfan Syndrome, Loeys-Deitz Aortic Aneurysm Syndrome, and the development of various types of tumors. Alternatively spliced transcript variants encoding different isoforms have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die in midgestation with impaired yolk sac hematopoiesis and vasculogenesis. Selective knockouts in bone marrow cells and cranial neural crest show inflammation and cleft palate/calvarial defects, respectively. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AB124611 T C 9: 21,529,085 probably null Het
Adamtsl1 G A 4: 86,156,689 D98N possibly damaging Het
Adgrb3 T C 1: 25,488,053 T601A probably benign Het
Ankrd33 C A 15: 101,119,449 Q248K probably benign Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
Casp12 G T 9: 5,352,263 C155F probably benign Het
Clpp T C 17: 56,990,661 V81A probably benign Het
Cyp3a59 A T 5: 146,090,685 I89F possibly damaging Het
Fam227b C A 2: 126,121,062 W178L probably damaging Het
Fcna C A 2: 25,624,851 R332L probably damaging Het
Gdf3 T G 6: 122,606,607 H267P probably damaging Het
Gm4450 G A 3: 98,456,415 T38I probably benign Het
Gm5592 A G 7: 41,288,551 D419G probably benign Het
Gm6882 A G 7: 21,427,295 V216A probably damaging Het
Gsdma3 A G 11: 98,629,777 N78S probably benign Het
Hydin T C 8: 110,569,392 I3579T probably benign Het
Ighmbp2 T C 19: 3,261,590 I942V probably damaging Het
Lamc1 A G 1: 153,230,769 Y1266H probably damaging Het
Lgi3 T C 14: 70,534,806 Y264H probably benign Het
Lmod2 G A 6: 24,603,385 E120K possibly damaging Het
Mbl2 G T 19: 30,239,484 C232F probably damaging Het
Morc1 T C 16: 48,460,740 V214A probably damaging Het
Nlrp4b T A 7: 10,725,953 C827* probably null Het
Olfr1086 A G 2: 86,676,805 F176S probably damaging Het
Olfr358 T A 2: 37,004,646 T323S probably benign Het
Pbrm1 T A 14: 31,027,462 H72Q possibly damaging Het
Plekhm2 T C 4: 141,627,825 I944V probably benign Het
Prdm8 A T 5: 98,184,531 D97V probably damaging Het
Preb G A 5: 30,960,117 probably benign Het
Prkcd T C 14: 30,609,251 K56E probably benign Het
Slit3 A T 11: 35,610,611 I391F probably damaging Het
Spata19 A G 9: 27,397,970 S91G probably benign Het
Stag3 A G 5: 138,308,588 T1134A probably benign Het
Tmtc2 A T 10: 105,413,236 I212N probably damaging Het
Tnfrsf26 C T 7: 143,614,902 R133K probably benign Het
Trim43c C A 9: 88,843,138 Q238K probably benign Het
Vcan T C 13: 89,688,743 D2894G probably benign Het
Wisp3 T A 10: 39,151,211 R342* probably null Het
Zeb2 C T 2: 45,022,996 S105N probably damaging Het
Other mutations in Tgfbr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Tgfbr2 APN 9 116110189 missense probably damaging 0.99
IGL00484:Tgfbr2 APN 9 116158289 missense probably benign 0.00
IGL01010:Tgfbr2 APN 9 116129980 missense possibly damaging 0.80
IGL01656:Tgfbr2 APN 9 116109669 missense probably damaging 1.00
IGL02496:Tgfbr2 APN 9 116090418 missense probably benign 0.13
IGL02550:Tgfbr2 APN 9 116110129 missense probably benign
IGL02563:Tgfbr2 APN 9 116129998 missense probably benign 0.10
IGL03403:Tgfbr2 APN 9 116110302 missense probably benign
IGL02799:Tgfbr2 UTSW 9 116110136 missense possibly damaging 0.50
R0617:Tgfbr2 UTSW 9 116158320 missense probably benign 0.00
R1483:Tgfbr2 UTSW 9 116109557 missense probably benign 0.04
R1776:Tgfbr2 UTSW 9 116174967 missense possibly damaging 0.94
R1777:Tgfbr2 UTSW 9 116109880 missense probably damaging 0.99
R1831:Tgfbr2 UTSW 9 116090536 missense possibly damaging 0.74
R2323:Tgfbr2 UTSW 9 116110144 missense possibly damaging 0.90
R2378:Tgfbr2 UTSW 9 116129950 missense probably benign 0.02
R3123:Tgfbr2 UTSW 9 116110069 missense possibly damaging 0.95
R3418:Tgfbr2 UTSW 9 116129833 missense probably damaging 1.00
R3605:Tgfbr2 UTSW 9 116109892 missense probably benign 0.03
R4039:Tgfbr2 UTSW 9 116175037 start codon destroyed probably null 0.62
R4191:Tgfbr2 UTSW 9 116109941 missense probably damaging 1.00
R4193:Tgfbr2 UTSW 9 116109941 missense probably damaging 1.00
R4945:Tgfbr2 UTSW 9 116131565 missense probably benign
R5431:Tgfbr2 UTSW 9 116131601 missense probably damaging 0.99
R5714:Tgfbr2 UTSW 9 116175024 missense probably damaging 0.98
R5964:Tgfbr2 UTSW 9 116110255 missense possibly damaging 0.64
R6180:Tgfbr2 UTSW 9 116110144 missense possibly damaging 0.90
R6970:Tgfbr2 UTSW 9 116110051 missense probably damaging 0.97
R7228:Tgfbr2 UTSW 9 116109943 missense probably damaging 1.00
R7258:Tgfbr2 UTSW 9 116129830 missense probably damaging 0.98
R7315:Tgfbr2 UTSW 9 116109738 missense possibly damaging 0.49
R8171:Tgfbr2 UTSW 9 116130006 nonsense probably null
R8175:Tgfbr2 UTSW 9 116109955 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ACTGCTCTGAGGTGTTCTGC -3'
(R):5'- CTCCAGAGCCTAATGCCTTC -3'

Sequencing Primer
(F):5'- GCTTCAGCTTGGCCTTGTAGAC -3'
(R):5'- GTCTTCTCTCCACATCAGAATACAC -3'
Posted On2020-10-20