Incidental Mutation 'R8417:Wisp3'
ID653005
Institutional Source Beutler Lab
Gene Symbol Wisp3
Ensembl Gene ENSMUSG00000062074
Gene NameWNT1 inducible signaling pathway protein 3
SynonymsLOC327743, CCN6
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8417 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location39150970-39163794 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 39151211 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 342 (R342*)
Ref Sequence ENSEMBL: ENSMUSP00000076003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019991] [ENSMUST00000076713] [ENSMUST00000213459]
Predicted Effect probably benign
Transcript: ENSMUST00000019991
SMART Domains Protein: ENSMUSP00000019991
Gene: ENSMUSG00000019845

DomainStartEndE-ValueType
Tubulin 55 277 1.08e-38 SMART
Tubulin_C 279 414 9.81e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000076713
AA Change: R342*
SMART Domains Protein: ENSMUSP00000076003
Gene: ENSMUSG00000062074
AA Change: R342*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IB 46 116 1.01e-15 SMART
Blast:VWC 122 179 1e-27 BLAST
TSP1 211 253 6.58e-5 SMART
CT 273 342 1.23e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213459
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WNT1 inducible signaling pathway (WISP) protein subfamily, which belongs to the connective tissue growth factor (CTGF) family. WNT1 is a member of a family of cysteine-rich, glycosylated signaling proteins that mediate diverse developmental processes. The CTGF family members are characterized by four conserved cysteine-rich domains: insulin-like growth factor-binding domain, von Willebrand factor type C module, thrombospondin domain and C-terminal cystine knot-like domain. This gene is overexpressed in colon tumors. It may be downstream in the WNT1 signaling pathway that is relevant to malignant transformation. Mutations of this gene are associated with progressive pseudorheumatoid dysplasia, an autosomal recessive skeletal disorder, indicating that the gene is essential for normal postnatal skeletal growth and cartilage homeostasis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile with no obvious abnormalities in size, weight, skeletal development, ossification, or the occurrence of joint disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AB124611 T C 9: 21,529,085 probably null Het
Adamtsl1 G A 4: 86,156,689 D98N possibly damaging Het
Adgrb3 T C 1: 25,488,053 T601A probably benign Het
Ankrd33 C A 15: 101,119,449 Q248K probably benign Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
Casp12 G T 9: 5,352,263 C155F probably benign Het
Clpp T C 17: 56,990,661 V81A probably benign Het
Cyp3a59 A T 5: 146,090,685 I89F possibly damaging Het
Fam227b C A 2: 126,121,062 W178L probably damaging Het
Fcna C A 2: 25,624,851 R332L probably damaging Het
Gdf3 T G 6: 122,606,607 H267P probably damaging Het
Gm4450 G A 3: 98,456,415 T38I probably benign Het
Gm5592 A G 7: 41,288,551 D419G probably benign Het
Gm6882 A G 7: 21,427,295 V216A probably damaging Het
Gsdma3 A G 11: 98,629,777 N78S probably benign Het
Hydin T C 8: 110,569,392 I3579T probably benign Het
Ighmbp2 T C 19: 3,261,590 I942V probably damaging Het
Lamc1 A G 1: 153,230,769 Y1266H probably damaging Het
Lgi3 T C 14: 70,534,806 Y264H probably benign Het
Lmod2 G A 6: 24,603,385 E120K possibly damaging Het
Mbl2 G T 19: 30,239,484 C232F probably damaging Het
Morc1 T C 16: 48,460,740 V214A probably damaging Het
Nlrp4b T A 7: 10,725,953 C827* probably null Het
Olfr1086 A G 2: 86,676,805 F176S probably damaging Het
Olfr358 T A 2: 37,004,646 T323S probably benign Het
Pbrm1 T A 14: 31,027,462 H72Q possibly damaging Het
Plekhm2 T C 4: 141,627,825 I944V probably benign Het
Prdm8 A T 5: 98,184,531 D97V probably damaging Het
Preb G A 5: 30,960,117 probably benign Het
Prkcd T C 14: 30,609,251 K56E probably benign Het
Slit3 A T 11: 35,610,611 I391F probably damaging Het
Spata19 A G 9: 27,397,970 S91G probably benign Het
Stag3 A G 5: 138,308,588 T1134A probably benign Het
Tgfbr2 A T 9: 116,110,129 M235K probably benign Het
Tmtc2 A T 10: 105,413,236 I212N probably damaging Het
Tnfrsf26 C T 7: 143,614,902 R133K probably benign Het
Trim43c C A 9: 88,843,138 Q238K probably benign Het
Vcan T C 13: 89,688,743 D2894G probably benign Het
Zeb2 C T 2: 45,022,996 S105N probably damaging Het
Other mutations in Wisp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Wisp3 APN 10 39158310 missense probably damaging 1.00
IGL02429:Wisp3 APN 10 39154993 missense probably benign 0.03
IGL02675:Wisp3 APN 10 39151240 missense possibly damaging 0.77
IGL03160:Wisp3 APN 10 39153237 missense probably damaging 1.00
IGL03214:Wisp3 APN 10 39153167 missense probably benign 0.04
R0666:Wisp3 UTSW 10 39151289 missense probably benign 0.45
R1350:Wisp3 UTSW 10 39158306 missense probably damaging 1.00
R1478:Wisp3 UTSW 10 39153243 missense probably damaging 1.00
R1479:Wisp3 UTSW 10 39153243 missense probably damaging 1.00
R1624:Wisp3 UTSW 10 39153243 missense probably damaging 1.00
R3833:Wisp3 UTSW 10 39154949 missense probably benign 0.00
R3975:Wisp3 UTSW 10 39155098 missense probably damaging 1.00
R5051:Wisp3 UTSW 10 39155156 missense probably benign 0.00
R6000:Wisp3 UTSW 10 39158300 missense probably damaging 1.00
R6492:Wisp3 UTSW 10 39154987 missense probably benign 0.01
R6775:Wisp3 UTSW 10 39151355 missense probably damaging 0.99
R7053:Wisp3 UTSW 10 39158301 missense probably damaging 1.00
R7138:Wisp3 UTSW 10 39158477 missense possibly damaging 0.80
R7253:Wisp3 UTSW 10 39155035 missense probably benign 0.04
R7367:Wisp3 UTSW 10 39158265 missense probably damaging 1.00
R7475:Wisp3 UTSW 10 39158300 missense probably damaging 1.00
R8547:Wisp3 UTSW 10 39151198
Predicted Primers PCR Primer
(F):5'- AGCAAGCTAAGAATGGTCACTATC -3'
(R):5'- GGAGAAACATGTCAACCCACTTTC -3'

Sequencing Primer
(F):5'- GCTAAGAATGGTCACTATCTCTGTG -3'
(R):5'- TTTCCAACTCCCCAAAGCTG -3'
Posted On2020-10-20