Incidental Mutation 'R8417:Lgi3'
ID653012
Institutional Source Beutler Lab
Gene Symbol Lgi3
Ensembl Gene ENSMUSG00000033595
Gene Nameleucine-rich repeat LGI family, member 3
Synonyms
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_145219.4; MGI: 2182619

Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R8417 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location70530685-70538324 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70534806 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 264 (Y264H)
Ref Sequence ENSEMBL: ENSMUSP00000046705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047331] [ENSMUST00000226548]
Predicted Effect probably benign
Transcript: ENSMUST00000047331
AA Change: Y264H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000046705
Gene: ENSMUSG00000033595
AA Change: Y264H

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 31 47 N/A INTRINSIC
LRR 87 110 2.63e0 SMART
LRR 111 134 1.07e0 SMART
LRR_TYP 135 158 2.84e-5 SMART
LRRCT 170 219 2.76e-4 SMART
Pfam:EPTP 222 263 7.6e-13 PFAM
Pfam:EPTP 268 309 1.3e-12 PFAM
Pfam:EPTP 314 360 1.1e-14 PFAM
Pfam:EPTP 363 405 2.4e-9 PFAM
Pfam:EPTP 410 452 1.2e-11 PFAM
Pfam:EPTP 455 496 2.2e-12 PFAM
Pfam:EPTP 501 541 2.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226548
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AB124611 T C 9: 21,529,085 probably null Het
Adamtsl1 G A 4: 86,156,689 D98N possibly damaging Het
Adgrb3 T C 1: 25,488,053 T601A probably benign Het
Ankrd33 C A 15: 101,119,449 Q248K probably benign Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
Casp12 G T 9: 5,352,263 C155F probably benign Het
Clpp T C 17: 56,990,661 V81A probably benign Het
Cyp3a59 A T 5: 146,090,685 I89F possibly damaging Het
Fam227b C A 2: 126,121,062 W178L probably damaging Het
Fcna C A 2: 25,624,851 R332L probably damaging Het
Gdf3 T G 6: 122,606,607 H267P probably damaging Het
Gm4450 G A 3: 98,456,415 T38I probably benign Het
Gm5592 A G 7: 41,288,551 D419G probably benign Het
Gm6882 A G 7: 21,427,295 V216A probably damaging Het
Gsdma3 A G 11: 98,629,777 N78S probably benign Het
Hydin T C 8: 110,569,392 I3579T probably benign Het
Ighmbp2 T C 19: 3,261,590 I942V probably damaging Het
Lamc1 A G 1: 153,230,769 Y1266H probably damaging Het
Lmod2 G A 6: 24,603,385 E120K possibly damaging Het
Mbl2 G T 19: 30,239,484 C232F probably damaging Het
Morc1 T C 16: 48,460,740 V214A probably damaging Het
Nlrp4b T A 7: 10,725,953 C827* probably null Het
Olfr1086 A G 2: 86,676,805 F176S probably damaging Het
Olfr358 T A 2: 37,004,646 T323S probably benign Het
Pbrm1 T A 14: 31,027,462 H72Q possibly damaging Het
Plekhm2 T C 4: 141,627,825 I944V probably benign Het
Prdm8 A T 5: 98,184,531 D97V probably damaging Het
Preb G A 5: 30,960,117 probably benign Het
Prkcd T C 14: 30,609,251 K56E probably benign Het
Slit3 A T 11: 35,610,611 I391F probably damaging Het
Spata19 A G 9: 27,397,970 S91G probably benign Het
Stag3 A G 5: 138,308,588 T1134A probably benign Het
Tgfbr2 A T 9: 116,110,129 M235K probably benign Het
Tmtc2 A T 10: 105,413,236 I212N probably damaging Het
Tnfrsf26 C T 7: 143,614,902 R133K probably benign Het
Trim43c C A 9: 88,843,138 Q238K probably benign Het
Vcan T C 13: 89,688,743 D2894G probably benign Het
Wisp3 T A 10: 39,151,211 R342* probably null Het
Zeb2 C T 2: 45,022,996 S105N probably damaging Het
Other mutations in Lgi3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01639:Lgi3 APN 14 70533385 missense probably benign 0.05
IGL02203:Lgi3 APN 14 70534518 missense possibly damaging 0.68
P0007:Lgi3 UTSW 14 70536712 missense probably damaging 1.00
R0114:Lgi3 UTSW 14 70531029 start gained probably benign
R0225:Lgi3 UTSW 14 70532821 missense probably benign
R0242:Lgi3 UTSW 14 70534815 nonsense probably null
R0242:Lgi3 UTSW 14 70534815 nonsense probably null
R0244:Lgi3 UTSW 14 70534698 missense probably benign 0.30
R0396:Lgi3 UTSW 14 70534840 missense probably damaging 1.00
R0479:Lgi3 UTSW 14 70534552 unclassified probably benign
R1652:Lgi3 UTSW 14 70531216 missense probably damaging 0.99
R1840:Lgi3 UTSW 14 70534776 splice site probably null
R1930:Lgi3 UTSW 14 70536268 missense probably damaging 0.98
R1931:Lgi3 UTSW 14 70536268 missense probably damaging 0.98
R2474:Lgi3 UTSW 14 70533249 critical splice donor site probably null
R4672:Lgi3 UTSW 14 70534457 missense possibly damaging 0.62
R5979:Lgi3 UTSW 14 70536460 missense probably damaging 1.00
R6385:Lgi3 UTSW 14 70531170 missense possibly damaging 0.66
R7146:Lgi3 UTSW 14 70533392 missense probably damaging 1.00
R7314:Lgi3 UTSW 14 70532112 missense probably damaging 1.00
R7712:Lgi3 UTSW 14 70531111 missense unknown
R8124:Lgi3 UTSW 14 70534738 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTTCCTACTACCACCCAGTG -3'
(R):5'- CAGGGCTAGAATTGGTTCAAAG -3'

Sequencing Primer
(F):5'- CAGTGGGTTGGTGCCTTATTCC -3'
(R):5'- AGGGCTAGAATTGGTTCAAAGTGTTC -3'
Posted On2020-10-20