Incidental Mutation 'R8417:Ankrd33'
ID653013
Institutional Source Beutler Lab
Gene Symbol Ankrd33
Ensembl Gene ENSMUSG00000047034
Gene Nameankyrin repeat domain 33
SynonymsPanky, A930021G21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R8417 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location101115755-101120040 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 101119449 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 248 (Q248K)
Ref Sequence ENSEMBL: ENSMUSP00000067028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070875] [ENSMUST00000229263] [ENSMUST00000229842] [ENSMUST00000229930] [ENSMUST00000229954] [ENSMUST00000231158]
Predicted Effect probably benign
Transcript: ENSMUST00000070875
AA Change: Q248K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000067028
Gene: ENSMUSG00000047034
AA Change: Q248K

DomainStartEndE-ValueType
ANK 5 35 1.19e3 SMART
ANK 39 68 9.13e-4 SMART
ANK 74 103 1.9e-1 SMART
ANK 108 137 4.88e2 SMART
low complexity region 149 171 N/A INTRINSIC
Blast:ANK 184 207 5e-6 BLAST
low complexity region 237 254 N/A INTRINSIC
low complexity region 315 324 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229263
Predicted Effect probably benign
Transcript: ENSMUST00000229842
Predicted Effect probably benign
Transcript: ENSMUST00000229930
Predicted Effect unknown
Transcript: ENSMUST00000229954
AA Change: Q296K
Predicted Effect probably benign
Transcript: ENSMUST00000231158
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AB124611 T C 9: 21,529,085 probably null Het
Adamtsl1 G A 4: 86,156,689 D98N possibly damaging Het
Adgrb3 T C 1: 25,488,053 T601A probably benign Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
Casp12 G T 9: 5,352,263 C155F probably benign Het
Clpp T C 17: 56,990,661 V81A probably benign Het
Cyp3a59 A T 5: 146,090,685 I89F possibly damaging Het
Fam227b C A 2: 126,121,062 W178L probably damaging Het
Fcna C A 2: 25,624,851 R332L probably damaging Het
Gdf3 T G 6: 122,606,607 H267P probably damaging Het
Gm4450 G A 3: 98,456,415 T38I probably benign Het
Gm5592 A G 7: 41,288,551 D419G probably benign Het
Gm6882 A G 7: 21,427,295 V216A probably damaging Het
Gsdma3 A G 11: 98,629,777 N78S probably benign Het
Hydin T C 8: 110,569,392 I3579T probably benign Het
Ighmbp2 T C 19: 3,261,590 I942V probably damaging Het
Lamc1 A G 1: 153,230,769 Y1266H probably damaging Het
Lgi3 T C 14: 70,534,806 Y264H probably benign Het
Lmod2 G A 6: 24,603,385 E120K possibly damaging Het
Mbl2 G T 19: 30,239,484 C232F probably damaging Het
Morc1 T C 16: 48,460,740 V214A probably damaging Het
Nlrp4b T A 7: 10,725,953 C827* probably null Het
Olfr1086 A G 2: 86,676,805 F176S probably damaging Het
Olfr358 T A 2: 37,004,646 T323S probably benign Het
Pbrm1 T A 14: 31,027,462 H72Q possibly damaging Het
Plekhm2 T C 4: 141,627,825 I944V probably benign Het
Prdm8 A T 5: 98,184,531 D97V probably damaging Het
Preb G A 5: 30,960,117 probably benign Het
Prkcd T C 14: 30,609,251 K56E probably benign Het
Slit3 A T 11: 35,610,611 I391F probably damaging Het
Spata19 A G 9: 27,397,970 S91G probably benign Het
Stag3 A G 5: 138,308,588 T1134A probably benign Het
Tgfbr2 A T 9: 116,110,129 M235K probably benign Het
Tmtc2 A T 10: 105,413,236 I212N probably damaging Het
Tnfrsf26 C T 7: 143,614,902 R133K probably benign Het
Trim43c C A 9: 88,843,138 Q238K probably benign Het
Vcan T C 13: 89,688,743 D2894G probably benign Het
Wisp3 T A 10: 39,151,211 R342* probably null Het
Zeb2 C T 2: 45,022,996 S105N probably damaging Het
Other mutations in Ankrd33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00549:Ankrd33 APN 15 101116959 missense probably damaging 1.00
IGL02458:Ankrd33 APN 15 101116607 missense probably damaging 1.00
R1830:Ankrd33 UTSW 15 101119551 missense probably damaging 1.00
R2072:Ankrd33 UTSW 15 101119636 missense probably benign 0.10
R6028:Ankrd33 UTSW 15 101119072 missense probably damaging 1.00
R6904:Ankrd33 UTSW 15 101117112 splice site probably null
R7022:Ankrd33 UTSW 15 101116899 missense probably benign 0.14
R7074:Ankrd33 UTSW 15 101119549 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TACAGGCTACTCTGAGCCTCTC -3'
(R):5'- GGAATGTGTCTTACTTGCTGCC -3'

Sequencing Primer
(F):5'- CAGGAAGGGGGTGTCCTG -3'
(R):5'- AGGAGCCAGACTTTGCTGC -3'
Posted On2020-10-20