Mutagenetix > Incidental Mutations

Incidental Mutation 'R8417:Morc1'

653014

Institutional Source

Beutler Lab

Gene Symbol

Morc1

Ensembl Gene

ENSMUSG00000022652

Gene Name

microrchidia 1

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.277) question?

Stock #

R8417 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

48431237-48630900 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 48460740 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 214 (V214A)

Ref Sequence

ENSEMBL: ENSMUSP00000023330 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023330]

Predicted Effect

probably damaging
Transcript: ENSMUST00000023330
AA Change: V214A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000023330
Gene: ENSMUSG00000022652
AA Change: V214A

Domain	Start	End	E-Value	Type
Pfam:HATPase_c_3	24	161	3.8e-21	PFAM
low complexity region	196	206	N/A	INTRINSIC
coiled coil region	281	311	N/A	INTRINSIC
Pfam:zf-CW	481	528	2e-14	PFAM
low complexity region	639	651	N/A	INTRINSIC
coiled coil region	885	916	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the human homolog of mouse morc and like the mouse protein it is testis-specific. Mouse studies support a testis-specific function since only male knockout mice are infertile; infertility is the only apparent defect. These studies further support a role for this protein early in spermatogenesis, possibly by affecting entry into apoptosis because testis from knockout mice show greatly increased numbers of apoptotic cells. [provided by RefSeq, Jan 2009]
PHENOTYPE: Inactivation of this locus results in small testes and male sterility, the latter owing to meiotic arrest. Mutant females exhibited histologically normal ovaries and were fertile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AB124611	T	C	9: 21,529,085		probably null	Het
Adamtsl1	G	A	4: 86,156,689	D98N	possibly damaging	Het
Adgrb3	T	C	1: 25,488,053	T601A	probably benign	Het
Ankrd33	C	A	15: 101,119,449	Q248K	probably benign	Het
Bsn	G	A	9: 108,111,452	A2367V	probably benign	Het
Casp12	G	T	9: 5,352,263	C155F	probably benign	Het
Clpp	T	C	17: 56,990,661	V81A	probably benign	Het
Cyp3a59	A	T	5: 146,090,685	I89F	possibly damaging	Het
Fam227b	C	A	2: 126,121,062	W178L	probably damaging	Het
Fcna	C	A	2: 25,624,851	R332L	probably damaging	Het
Gdf3	T	G	6: 122,606,607	H267P	probably damaging	Het
Gm4450	G	A	3: 98,456,415	T38I	probably benign	Het
Gm5592	A	G	7: 41,288,551	D419G	probably benign	Het
Gm6882	A	G	7: 21,427,295	V216A	probably damaging	Het
Gsdma3	A	G	11: 98,629,777	N78S	probably benign	Het
Hydin	T	C	8: 110,569,392	I3579T	probably benign	Het
Ighmbp2	T	C	19: 3,261,590	I942V	probably damaging	Het
Lamc1	A	G	1: 153,230,769	Y1266H	probably damaging	Het
Lgi3	T	C	14: 70,534,806	Y264H	probably benign	Het
Lmod2	G	A	6: 24,603,385	E120K	possibly damaging	Het
Mbl2	G	T	19: 30,239,484	C232F	probably damaging	Het
Nlrp4b	T	A	7: 10,725,953	C827*	probably null	Het
Olfr1086	A	G	2: 86,676,805	F176S	probably damaging	Het
Olfr358	T	A	2: 37,004,646	T323S	probably benign	Het
Pbrm1	T	A	14: 31,027,462	H72Q	possibly damaging	Het
Plekhm2	T	C	4: 141,627,825	I944V	probably benign	Het
Prdm8	A	T	5: 98,184,531	D97V	probably damaging	Het
Preb	G	A	5: 30,960,117		probably benign	Het
Prkcd	T	C	14: 30,609,251	K56E	probably benign	Het
Slit3	A	T	11: 35,610,611	I391F	probably damaging	Het
Spata19	A	G	9: 27,397,970	S91G	probably benign	Het
Stag3	A	G	5: 138,308,588	T1134A	probably benign	Het
Tgfbr2	A	T	9: 116,110,129	M235K	probably benign	Het
Tmtc2	A	T	10: 105,413,236	I212N	probably damaging	Het
Tnfrsf26	C	T	7: 143,614,902	R133K	probably benign	Het
Trim43c	C	A	9: 88,843,138	Q238K	probably benign	Het
Vcan	T	C	13: 89,688,743	D2894G	probably benign	Het
Wisp3	T	A	10: 39,151,211	R342*	probably null	Het
Zeb2	C	T	2: 45,022,996	S105N	probably damaging	Het

Other mutations in Morc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00763:Morc1	APN	16	48612326	missense	probably damaging	0.98
IGL00815:Morc1	APN	16	48460692	missense	possibly damaging	0.62
IGL00939:Morc1	APN	16	48452589	missense	probably damaging	0.99
IGL01321:Morc1	APN	16	48582462	missense	probably benign	0.00
IGL01410:Morc1	APN	16	48612314	missense	probably benign	0.16
IGL01557:Morc1	APN	16	48498766	missense	probably damaging	1.00
IGL02118:Morc1	APN	16	48587104	missense	probably benign	0.01
IGL02626:Morc1	APN	16	48615760	missense	probably damaging	0.96
IGL02692:Morc1	APN	16	48510233	missense	probably null	0.95
IGL02812:Morc1	APN	16	48558506	splice site	probably benign
IGL03232:Morc1	APN	16	48630802	missense	probably benign	0.06
IGL03331:Morc1	APN	16	48612368	splice site	probably benign
IGL03408:Morc1	APN	16	48442412	missense	probably damaging	1.00
R0545:Morc1	UTSW	16	48565657	missense	probably benign	0.05
R0569:Morc1	UTSW	16	48587122	missense	probably benign	0.02
R0699:Morc1	UTSW	16	48592614	missense	probably benign	0.01
R1717:Morc1	UTSW	16	48452477	missense	probably benign	0.01
R1728:Morc1	UTSW	16	48612297	missense	probably benign	0.10
R1803:Morc1	UTSW	16	48622638	missense	probably benign	0.14
R1864:Morc1	UTSW	16	48592530	missense	probably benign	0.01
R2008:Morc1	UTSW	16	48565646	missense	probably benign	0.41
R2070:Morc1	UTSW	16	48592611	missense	probably benign	0.00
R2071:Morc1	UTSW	16	48592611	missense	probably benign	0.00
R4851:Morc1	UTSW	16	48561617	missense	probably benign	0.02
R5013:Morc1	UTSW	16	48502336	missense	probably benign	0.11
R5081:Morc1	UTSW	16	48502352	missense	probably benign	0.01
R5259:Morc1	UTSW	16	48630769	missense	probably benign	0.12
R5342:Morc1	UTSW	16	48618509	missense	probably damaging	0.99
R5481:Morc1	UTSW	16	48561485	splice site	probably null
R5561:Morc1	UTSW	16	48449348	missense	probably benign	0.43
R6356:Morc1	UTSW	16	48437289	missense	probably damaging	1.00
R6526:Morc1	UTSW	16	48587124	nonsense	probably null
R6743:Morc1	UTSW	16	48502320	missense	probably damaging	0.98
R6940:Morc1	UTSW	16	48479845	nonsense	probably null
R6994:Morc1	UTSW	16	48565621	missense	probably benign	0.00
R6994:Morc1	UTSW	16	48618546	missense	probably benign	0.39
R7009:Morc1	UTSW	16	48627070	missense	possibly damaging	0.69
R7346:Morc1	UTSW	16	48630900	splice site	probably null
R7357:Morc1	UTSW	16	48622590	missense	probably benign	0.14
R7448:Morc1	UTSW	16	48431345	missense	probably damaging	0.97
R7840:Morc1	UTSW	16	48498784	missense	probably benign	0.03
X0013:Morc1	UTSW	16	48587068	missense	probably benign	0.04
X0027:Morc1	UTSW	16	48498811	missense	probably damaging	1.00
Z1176:Morc1	UTSW	16	48587058	missense	probably benign	0.03
Z1177:Morc1	UTSW	16	48565706	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- ATTTCCCAGAAAGCATGGCT -3'
(R):5'- CGTGTCGAGGACTTTTGGGA -3'

Sequencing Primer
(F):5'- TCTGCATTGAAGGGTCACAGC -3'
(R):5'- ACTTTTGGGATAGCATTGGAAATG -3'

Posted On

2020-10-20