Incidental Mutation 'R8417:Clpp'
ID653015
Institutional Source Beutler Lab
Gene Symbol Clpp
Ensembl Gene ENSMUSG00000002660
Gene Namecaseinolytic mitochondrial matrix peptidase proteolytic subunit
SynonymsD17Wsu160e
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.616) question?
Stock #R8417 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location56990264-56996371 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56990661 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 81 (V81A)
Ref Sequence ENSEMBL: ENSMUSP00000002735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002735]
Predicted Effect probably benign
Transcript: ENSMUST00000002735
AA Change: V81A

PolyPhen 2 Score 0.314 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000002735
Gene: ENSMUSG00000002660
AA Change: V81A

DomainStartEndE-ValueType
Pfam:CLP_protease 63 244 8.8e-82 PFAM
low complexity region 259 270 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the peptidase family S14 and hydrolyzes proteins into small peptides in the presence of ATP and magnesium. The protein is transported into mitochondrial matrix and is associated with the inner mitochondrial membrane. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit infertility, hearing loss, growth retardation, reduced activity, T cell activation, increased mitochondrial DNA and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AB124611 T C 9: 21,529,085 probably null Het
Adamtsl1 G A 4: 86,156,689 D98N possibly damaging Het
Adgrb3 T C 1: 25,488,053 T601A probably benign Het
Ankrd33 C A 15: 101,119,449 Q248K probably benign Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
Casp12 G T 9: 5,352,263 C155F probably benign Het
Cyp3a59 A T 5: 146,090,685 I89F possibly damaging Het
Fam227b C A 2: 126,121,062 W178L probably damaging Het
Fcna C A 2: 25,624,851 R332L probably damaging Het
Gdf3 T G 6: 122,606,607 H267P probably damaging Het
Gm4450 G A 3: 98,456,415 T38I probably benign Het
Gm5592 A G 7: 41,288,551 D419G probably benign Het
Gm6882 A G 7: 21,427,295 V216A probably damaging Het
Gsdma3 A G 11: 98,629,777 N78S probably benign Het
Hydin T C 8: 110,569,392 I3579T probably benign Het
Ighmbp2 T C 19: 3,261,590 I942V probably damaging Het
Lamc1 A G 1: 153,230,769 Y1266H probably damaging Het
Lgi3 T C 14: 70,534,806 Y264H probably benign Het
Lmod2 G A 6: 24,603,385 E120K possibly damaging Het
Mbl2 G T 19: 30,239,484 C232F probably damaging Het
Morc1 T C 16: 48,460,740 V214A probably damaging Het
Nlrp4b T A 7: 10,725,953 C827* probably null Het
Olfr1086 A G 2: 86,676,805 F176S probably damaging Het
Olfr358 T A 2: 37,004,646 T323S probably benign Het
Pbrm1 T A 14: 31,027,462 H72Q possibly damaging Het
Plekhm2 T C 4: 141,627,825 I944V probably benign Het
Prdm8 A T 5: 98,184,531 D97V probably damaging Het
Preb G A 5: 30,960,117 probably benign Het
Prkcd T C 14: 30,609,251 K56E probably benign Het
Slit3 A T 11: 35,610,611 I391F probably damaging Het
Spata19 A G 9: 27,397,970 S91G probably benign Het
Stag3 A G 5: 138,308,588 T1134A probably benign Het
Tgfbr2 A T 9: 116,110,129 M235K probably benign Het
Tmtc2 A T 10: 105,413,236 I212N probably damaging Het
Tnfrsf26 C T 7: 143,614,902 R133K probably benign Het
Trim43c C A 9: 88,843,138 Q238K probably benign Het
Vcan T C 13: 89,688,743 D2894G probably benign Het
Wisp3 T A 10: 39,151,211 R342* probably null Het
Zeb2 C T 2: 45,022,996 S105N probably damaging Het
Other mutations in Clpp
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0722:Clpp UTSW 17 56992901 missense probably damaging 0.99
R1891:Clpp UTSW 17 56991307 missense probably damaging 0.99
R1950:Clpp UTSW 17 56996039 unclassified probably benign
R7089:Clpp UTSW 17 56990421 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCATCCCCATAGTGGTGGAG -3'
(R):5'- TTGGGAAGCTATGGCAGGAC -3'

Sequencing Primer
(F):5'- CCCATAGTGGTGGAGCAGAC -3'
(R):5'- GGGCTAGCCTGTACTACAAAGC -3'
Posted On2020-10-20