Incidental Mutation 'R8417:Mbl2'
ID653017
Institutional Source Beutler Lab
Gene Symbol Mbl2
Ensembl Gene ENSMUSG00000024863
Gene Namemannose-binding lectin (protein C) 2
SynonymsMBL-C, MBL, MBP-C
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8417 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location30232928-30239685 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 30239484 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 232 (C232F)
Ref Sequence ENSEMBL: ENSMUSP00000025797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025797]
Predicted Effect probably damaging
Transcript: ENSMUST00000025797
AA Change: C232F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025797
Gene: ENSMUSG00000024863
AA Change: C232F

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Collagen 35 98 1.8e-10 PFAM
CLECT 117 241 3.52e-20 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the soluble mannose-binding lectin or mannose-binding protein found in serum. The protein encoded belongs to the collectin family and is an important element in the innate immune system. The protein recognizes mannose and N-acetylglucosamine on many microorganisms, and is capable of activating the classical complement pathway. Deficiencies of this gene have been associated with susceptibility to autoimmune and infectious diseases. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AB124611 T C 9: 21,529,085 probably null Het
Adamtsl1 G A 4: 86,156,689 D98N possibly damaging Het
Adgrb3 T C 1: 25,488,053 T601A probably benign Het
Ankrd33 C A 15: 101,119,449 Q248K probably benign Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
Casp12 G T 9: 5,352,263 C155F probably benign Het
Clpp T C 17: 56,990,661 V81A probably benign Het
Cyp3a59 A T 5: 146,090,685 I89F possibly damaging Het
Fam227b C A 2: 126,121,062 W178L probably damaging Het
Fcna C A 2: 25,624,851 R332L probably damaging Het
Gdf3 T G 6: 122,606,607 H267P probably damaging Het
Gm4450 G A 3: 98,456,415 T38I probably benign Het
Gm5592 A G 7: 41,288,551 D419G probably benign Het
Gm6882 A G 7: 21,427,295 V216A probably damaging Het
Gsdma3 A G 11: 98,629,777 N78S probably benign Het
Hydin T C 8: 110,569,392 I3579T probably benign Het
Ighmbp2 T C 19: 3,261,590 I942V probably damaging Het
Lamc1 A G 1: 153,230,769 Y1266H probably damaging Het
Lgi3 T C 14: 70,534,806 Y264H probably benign Het
Lmod2 G A 6: 24,603,385 E120K possibly damaging Het
Morc1 T C 16: 48,460,740 V214A probably damaging Het
Nlrp4b T A 7: 10,725,953 C827* probably null Het
Olfr1086 A G 2: 86,676,805 F176S probably damaging Het
Olfr358 T A 2: 37,004,646 T323S probably benign Het
Pbrm1 T A 14: 31,027,462 H72Q possibly damaging Het
Plekhm2 T C 4: 141,627,825 I944V probably benign Het
Prdm8 A T 5: 98,184,531 D97V probably damaging Het
Preb G A 5: 30,960,117 probably benign Het
Prkcd T C 14: 30,609,251 K56E probably benign Het
Slit3 A T 11: 35,610,611 I391F probably damaging Het
Spata19 A G 9: 27,397,970 S91G probably benign Het
Stag3 A G 5: 138,308,588 T1134A probably benign Het
Tgfbr2 A T 9: 116,110,129 M235K probably benign Het
Tmtc2 A T 10: 105,413,236 I212N probably damaging Het
Tnfrsf26 C T 7: 143,614,902 R133K probably benign Het
Trim43c C A 9: 88,843,138 Q238K probably benign Het
Vcan T C 13: 89,688,743 D2894G probably benign Het
Wisp3 T A 10: 39,151,211 R342* probably null Het
Zeb2 C T 2: 45,022,996 S105N probably damaging Het
Other mutations in Mbl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Mbl2 APN 19 30238394 missense possibly damaging 0.70
R2174:Mbl2 UTSW 19 30234012 missense possibly damaging 0.76
R3836:Mbl2 UTSW 19 30239514 missense probably damaging 1.00
R4405:Mbl2 UTSW 19 30239516 missense probably benign 0.15
R6500:Mbl2 UTSW 19 30239439 missense possibly damaging 0.80
R7402:Mbl2 UTSW 19 30239402 missense possibly damaging 0.73
R7922:Mbl2 UTSW 19 30239238 missense probably damaging 1.00
R7981:Mbl2 UTSW 19 30239337 missense probably damaging 1.00
Z1177:Mbl2 UTSW 19 30233997 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGACAGAGTGAAGGCCCTG -3'
(R):5'- CCTTCACAAGAGAATGCATTGGG -3'

Sequencing Primer
(F):5'- TCCGAATTCCAGGGCTCTGTG -3'
(R):5'- CGTCAGGAGTACCCTAAAGA -3'
Posted On2020-10-20