Incidental Mutation 'R8418:Gm28360'
ID653018
Institutional Source Beutler Lab
Gene Symbol Gm28360
Ensembl Gene ENSMUSG00000100305
Gene Namepredicted gene 28360
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R8418 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location117830081-117854496 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 117853627 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 116 (H116L)
Ref Sequence ENSEMBL: ENSMUSP00000140444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000187455]
Predicted Effect probably benign
Transcript: ENSMUST00000187455
AA Change: H116L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000140444
Gene: ENSMUSG00000100305
AA Change: H116L

DomainStartEndE-ValueType
KRAB 8 66 1.9e-23 SMART
ZnF_C2H2 77 99 6.4e-7 SMART
ZnF_C2H2 105 127 3.4e-5 SMART
ZnF_C2H2 133 153 3e-1 SMART
ZnF_C2H2 161 183 1.7e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf2 T C 17: 42,710,586 H449R probably benign Het
Arfgef2 T C 2: 166,856,548 V646A probably benign Het
BC005561 C A 5: 104,519,858 Q749K possibly damaging Het
Bean1 CT C 8: 104,182,032 probably null Het
Ccdc155 A G 7: 45,194,077 L241P probably damaging Het
Ccdc62 C T 5: 123,946,392 R279* probably null Het
Col6a5 G T 9: 105,878,622 P2201Q probably damaging Het
Cpa3 T C 3: 20,222,151 Y306C probably damaging Het
Cpne9 A G 6: 113,283,437 N82D possibly damaging Het
Dcaf17 T A 2: 71,088,373 D430E probably damaging Het
Dcst2 T C 3: 89,371,594 V546A probably benign Het
Dennd1a T C 2: 37,858,391 T359A probably benign Het
Dgkb C A 12: 38,330,017 H591N probably damaging Het
Dnah17 G A 11: 118,103,458 S1047F probably benign Het
Dock2 A G 11: 34,718,968 I215T probably benign Het
Efcab12 A G 6: 115,822,115 probably null Het
Erich3 C T 3: 154,709,741 R165C Het
Fam166b A G 4: 43,427,204 L76P unknown Het
Gabrr1 C T 4: 33,162,615 R394* probably null Het
Garnl3 G T 2: 33,052,146 Q153K possibly damaging Het
Gars A G 6: 55,065,461 N393S probably damaging Het
Gbp2b A T 3: 142,603,705 E192D probably benign Het
Gp1bb T A 16: 18,621,353 H5L unknown Het
Grik3 A G 4: 125,686,042 K527E possibly damaging Het
Hhip T C 8: 80,045,085 M199V probably damaging Het
Irgm1 A G 11: 48,866,339 V231A probably damaging Het
Itgal A T 7: 127,330,282 I1124F probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Miga1 T G 3: 152,285,317 Y433S probably damaging Het
Muc16 A T 9: 18,519,630 I8062K possibly damaging Het
Ntsr2 T G 12: 16,656,661 V230G possibly damaging Het
Olfr597 A G 7: 103,321,071 Y220C Het
Ptpn2 G A 18: 67,681,522 T139M probably damaging Het
Pum2 T A 12: 8,710,245 D145E possibly damaging Het
Radil T C 5: 142,494,921 E593G probably benign Het
Rdh14 T C 12: 10,394,580 F144L probably damaging Het
Sec23ip T G 7: 128,778,463 D867E probably damaging Het
Serpina6 T C 12: 103,646,928 Y371C probably damaging Het
Snx13 T A 12: 35,098,234 I254N probably damaging Het
Tacc1 T C 8: 25,241,516 K7E probably damaging Het
Timeless A C 10: 128,250,736 N1048T probably benign Het
Tll2 C A 19: 41,092,837 E732D probably damaging Het
Tmem171 A G 13: 98,692,232 S137P probably damaging Het
Ttll3 A T 6: 113,394,773 M44L probably benign Het
Vmn2r29 T A 7: 7,241,940 I312L probably benign Het
Vmn2r43 A T 7: 8,255,584 L210* probably null Het
Vmn2r60 A G 7: 42,195,426 I738V probably damaging Het
Zfp977 T A 7: 42,579,986 M372L probably benign Het
Other mutations in Gm28360
AlleleSourceChrCoordTypePredicted EffectPPH Score
R6541:Gm28360 UTSW 1 117830317 start gained probably benign
R7038:Gm28360 UTSW 1 117853599 missense probably damaging 1.00
R7958:Gm28360 UTSW 1 117853679 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTCAGTCCCCAAATCCTAAGGC -3'
(R):5'- TGTGGTGAACTTGAAGAGATGA -3'

Sequencing Primer
(F):5'- CACACTACAGACTTTCTACTCGAGTG -3'
(R):5'- CCAGTATGCAATCTGTGGTGAAC -3'
Posted On2020-10-20