Incidental Mutation 'R8418:Garnl3'
ID653019
Institutional Source Beutler Lab
Gene Symbol Garnl3
Ensembl Gene ENSMUSG00000038860
Gene NameGTPase activating RANGAP domain-like 3
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.229) question?
Stock #R8418 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location32986224-33131654 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 33052146 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 153 (Q153K)
Ref Sequence ENSEMBL: ENSMUSP00000122576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049618] [ENSMUST00000102810] [ENSMUST00000124000] [ENSMUST00000127509] [ENSMUST00000133135] [ENSMUST00000137381]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049618
AA Change: Q112K

PolyPhen 2 Score 0.521 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000057582
Gene: ENSMUSG00000038860
AA Change: Q112K

DomainStartEndE-ValueType
Pfam:Rap_GAP 202 383 3.4e-73 PFAM
Pfam:CNH 475 780 3.5e-67 PFAM
low complexity region 793 804 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102810
AA Change: Q108K

PolyPhen 2 Score 0.652 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099874
Gene: ENSMUSG00000038860
AA Change: Q108K

DomainStartEndE-ValueType
Pfam:Rap_GAP 198 385 4.6e-67 PFAM
Pfam:CNH 471 776 1.8e-68 PFAM
low complexity region 789 800 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124000
SMART Domains Protein: ENSMUSP00000123601
Gene: ENSMUSG00000038860

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127509
Predicted Effect probably benign
Transcript: ENSMUST00000133135
Predicted Effect possibly damaging
Transcript: ENSMUST00000137381
AA Change: Q153K

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf2 T C 17: 42,710,586 H449R probably benign Het
Arfgef2 T C 2: 166,856,548 V646A probably benign Het
BC005561 C A 5: 104,519,858 Q749K possibly damaging Het
Bean1 CT C 8: 104,182,032 probably null Het
Ccdc155 A G 7: 45,194,077 L241P probably damaging Het
Ccdc62 C T 5: 123,946,392 R279* probably null Het
Col6a5 G T 9: 105,878,622 P2201Q probably damaging Het
Cpa3 T C 3: 20,222,151 Y306C probably damaging Het
Cpne9 A G 6: 113,283,437 N82D possibly damaging Het
Dcaf17 T A 2: 71,088,373 D430E probably damaging Het
Dcst2 T C 3: 89,371,594 V546A probably benign Het
Dennd1a T C 2: 37,858,391 T359A probably benign Het
Dgkb C A 12: 38,330,017 H591N probably damaging Het
Dnah17 G A 11: 118,103,458 S1047F probably benign Het
Dock2 A G 11: 34,718,968 I215T probably benign Het
Efcab12 A G 6: 115,822,115 probably null Het
Erich3 C T 3: 154,709,741 R165C Het
Fam166b A G 4: 43,427,204 L76P unknown Het
Gabrr1 C T 4: 33,162,615 R394* probably null Het
Gars A G 6: 55,065,461 N393S probably damaging Het
Gbp2b A T 3: 142,603,705 E192D probably benign Het
Gm28360 A T 1: 117,853,627 H116L probably benign Het
Gm9602 T A 14: 4,779,201 probably benign Het
Gp1bb T A 16: 18,621,353 H5L unknown Het
Grik3 A G 4: 125,686,042 K527E possibly damaging Het
Hhip T C 8: 80,045,085 M199V probably damaging Het
Irgm1 A G 11: 48,866,339 V231A probably damaging Het
Itgal A T 7: 127,330,282 I1124F probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Miga1 T G 3: 152,285,317 Y433S probably damaging Het
Muc16 A T 9: 18,519,630 I8062K possibly damaging Het
Ntsr2 T G 12: 16,656,661 V230G possibly damaging Het
Olfr597 A G 7: 103,321,071 Y220C Het
Ptpn2 G A 18: 67,681,522 T139M probably damaging Het
Pum2 T A 12: 8,710,245 D145E possibly damaging Het
Radil T C 5: 142,494,921 E593G probably benign Het
Rdh14 T C 12: 10,394,580 F144L probably damaging Het
Sec23ip T G 7: 128,778,463 D867E probably damaging Het
Serpina6 T C 12: 103,646,928 Y371C probably damaging Het
Snx13 T A 12: 35,098,234 I254N probably damaging Het
Tacc1 T C 8: 25,241,516 K7E probably damaging Het
Timeless A C 10: 128,250,736 N1048T probably benign Het
Tll2 C A 19: 41,092,837 E732D probably damaging Het
Tmem171 A G 13: 98,692,232 S137P probably damaging Het
Ttll3 A T 6: 113,394,773 M44L probably benign Het
Vmn2r29 T A 7: 7,241,940 I312L probably benign Het
Vmn2r43 A T 7: 8,255,584 L210* probably null Het
Vmn2r60 A G 7: 42,195,426 I738V probably damaging Het
Zfp977 T A 7: 42,579,986 M372L probably benign Het
Other mutations in Garnl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Garnl3 APN 2 33006816 missense probably damaging 1.00
IGL01601:Garnl3 APN 2 32997689 nonsense probably null
IGL01981:Garnl3 APN 2 32997729 missense probably damaging 0.98
IGL02209:Garnl3 APN 2 33085930 missense probably damaging 0.99
IGL02434:Garnl3 APN 2 33054205 missense probably damaging 1.00
IGL02512:Garnl3 APN 2 33031138 missense probably damaging 1.00
IGL02947:Garnl3 APN 2 33046594 missense probably damaging 1.00
PIT4403001:Garnl3 UTSW 2 32990758 missense probably damaging 1.00
R0123:Garnl3 UTSW 2 33006804 missense possibly damaging 0.92
R0134:Garnl3 UTSW 2 33006804 missense possibly damaging 0.92
R0225:Garnl3 UTSW 2 33006804 missense possibly damaging 0.92
R0551:Garnl3 UTSW 2 33016738 missense probably damaging 1.00
R0691:Garnl3 UTSW 2 33085907 missense probably damaging 1.00
R0693:Garnl3 UTSW 2 33085907 missense probably damaging 1.00
R0737:Garnl3 UTSW 2 32990642 missense probably damaging 0.98
R1350:Garnl3 UTSW 2 33052214 missense probably damaging 1.00
R1691:Garnl3 UTSW 2 32997663 nonsense probably null
R1791:Garnl3 UTSW 2 33034127 missense probably benign 0.02
R1938:Garnl3 UTSW 2 33005200 missense probably damaging 0.99
R2100:Garnl3 UTSW 2 33046645 missense probably benign 0.35
R2316:Garnl3 UTSW 2 33005152 missense probably damaging 1.00
R2353:Garnl3 UTSW 2 33064034 missense probably damaging 1.00
R3161:Garnl3 UTSW 2 33034711 missense probably damaging 1.00
R3839:Garnl3 UTSW 2 32989546 missense probably benign 0.00
R3847:Garnl3 UTSW 2 32992228 missense probably benign
R4871:Garnl3 UTSW 2 33087088 start codon destroyed probably null 0.77
R5682:Garnl3 UTSW 2 33054173 missense probably damaging 1.00
R5811:Garnl3 UTSW 2 33006899 missense probably damaging 0.99
R6267:Garnl3 UTSW 2 33104880 missense probably benign 0.20
R6502:Garnl3 UTSW 2 33006821 missense possibly damaging 0.67
R6532:Garnl3 UTSW 2 33031119 missense possibly damaging 0.87
R6639:Garnl3 UTSW 2 32989525 missense possibly damaging 0.75
R6763:Garnl3 UTSW 2 33054196 missense probably damaging 1.00
R6866:Garnl3 UTSW 2 33002773 splice site probably null
R6913:Garnl3 UTSW 2 32986829 missense possibly damaging 0.91
R7002:Garnl3 UTSW 2 33054193 missense possibly damaging 0.65
R7168:Garnl3 UTSW 2 32995078 missense probably damaging 1.00
R7341:Garnl3 UTSW 2 33034129 missense probably damaging 1.00
R7746:Garnl3 UTSW 2 32992257 missense probably damaging 1.00
R7919:Garnl3 UTSW 2 33046599 missense probably benign 0.38
R8079:Garnl3 UTSW 2 33018499 critical splice donor site probably null
R8087:Garnl3 UTSW 2 33045536 missense probably benign 0.01
R8123:Garnl3 UTSW 2 33104938 missense probably damaging 0.97
R8170:Garnl3 UTSW 2 33015223 missense possibly damaging 0.88
R8347:Garnl3 UTSW 2 33085891 missense probably damaging 1.00
R8679:Garnl3 UTSW 2 33026094 missense probably damaging 1.00
R8940:Garnl3 UTSW 2 33005229 critical splice acceptor site probably null
X0022:Garnl3 UTSW 2 33022668 missense probably damaging 1.00
X0023:Garnl3 UTSW 2 33026149 missense probably damaging 1.00
X0024:Garnl3 UTSW 2 33005179 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGCTCTGAATCATCTACAGTGAGAG -3'
(R):5'- TCCAAAGAGCTGATGCAAAGC -3'

Sequencing Primer
(F):5'- CTGAATCATCTACAGTGAGAGGAATC -3'
(R):5'- GGTATCAGAGGACTAGAACCTTTCC -3'
Posted On2020-10-20