Incidental Mutation 'R8418:Grik3'
ID 653030
Institutional Source Beutler Lab
Gene Symbol Grik3
Ensembl Gene ENSMUSG00000001985
Gene Name glutamate receptor, ionotropic, kainate 3
Synonyms Glur7, Glur-7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock # R8418 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 125490700-125714173 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 125686042 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 527 (K527E)
Ref Sequence ENSEMBL: ENSMUSP00000030676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030676]
AlphaFold B1AS29
Predicted Effect possibly damaging
Transcript: ENSMUST00000030676
AA Change: K527E

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000030676
Gene: ENSMUSG00000001985
AA Change: K527E

DomainStartEndE-ValueType
Pfam:ANF_receptor 55 398 7.8e-72 PFAM
PBPe 435 802 4.38e-133 SMART
Lig_chan-Glu_bd 445 509 5.77e-34 SMART
transmembrane domain 823 845 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to the kainate family of glutamate receptors, which are composed of four subunits and function as ligand-activated ion channels. Transcript variants encoding different isoforms have been described for this gene, however, their full-length nature is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit significantly reduced short- and long-term synaptic potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf2 T C 17: 42,710,586 H449R probably benign Het
Arfgef2 T C 2: 166,856,548 V646A probably benign Het
BC005561 C A 5: 104,519,858 Q749K possibly damaging Het
Bean1 CT C 8: 104,182,032 probably null Het
Ccdc155 A G 7: 45,194,077 L241P probably damaging Het
Ccdc62 C T 5: 123,946,392 R279* probably null Het
Col6a5 G T 9: 105,878,622 P2201Q probably damaging Het
Cpa3 T C 3: 20,222,151 Y306C probably damaging Het
Cpne9 A G 6: 113,283,437 N82D possibly damaging Het
Dcaf17 T A 2: 71,088,373 D430E probably damaging Het
Dcst2 T C 3: 89,371,594 V546A probably benign Het
Dennd1a T C 2: 37,858,391 T359A probably benign Het
Dgkb C A 12: 38,330,017 H591N probably damaging Het
Dnah17 G A 11: 118,103,458 S1047F probably benign Het
Dock2 A G 11: 34,718,968 I215T probably benign Het
Efcab12 A G 6: 115,822,115 probably null Het
Erich3 C T 3: 154,709,741 R165C Het
Fam166b A G 4: 43,427,204 L76P unknown Het
Gabrr1 C T 4: 33,162,615 R394* probably null Het
Garnl3 G T 2: 33,052,146 Q153K possibly damaging Het
Gars A G 6: 55,065,461 N393S probably damaging Het
Gbp2b A T 3: 142,603,705 E192D probably benign Het
Gm28360 A T 1: 117,853,627 H116L probably benign Het
Gm9602 T A 14: 4,779,201 probably benign Het
Gp1bb T A 16: 18,621,353 H5L unknown Het
Hhip T C 8: 80,045,085 M199V probably damaging Het
Irgm1 A G 11: 48,866,339 V231A probably damaging Het
Itgal A T 7: 127,330,282 I1124F probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Miga1 T G 3: 152,285,317 Y433S probably damaging Het
Muc16 A T 9: 18,519,630 I8062K possibly damaging Het
Ntsr2 T G 12: 16,656,661 V230G possibly damaging Het
Olfr597 A G 7: 103,321,071 Y220C Het
Ptpn2 G A 18: 67,681,522 T139M probably damaging Het
Pum2 T A 12: 8,710,245 D145E possibly damaging Het
Radil T C 5: 142,494,921 E593G probably benign Het
Rdh14 T C 12: 10,394,580 F144L probably damaging Het
Sec23ip T G 7: 128,778,463 D867E probably damaging Het
Serpina6 T C 12: 103,646,928 Y371C probably damaging Het
Snx13 T A 12: 35,098,234 I254N probably damaging Het
Tacc1 T C 8: 25,241,516 K7E probably damaging Het
Timeless A C 10: 128,250,736 N1048T probably benign Het
Tll2 C A 19: 41,092,837 E732D probably damaging Het
Tmem171 A G 13: 98,692,232 S137P probably damaging Het
Ttll3 A T 6: 113,394,773 M44L probably benign Het
Vmn2r29 T A 7: 7,241,940 I312L probably benign Het
Vmn2r43 A T 7: 8,255,584 L210* probably null Het
Vmn2r60 A G 7: 42,195,426 I738V probably damaging Het
Zfp977 T A 7: 42,579,986 M372L probably benign Het
Other mutations in Grik3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:Grik3 APN 4 125632415 missense probably benign
IGL01534:Grik3 APN 4 125686190 missense probably damaging 1.00
IGL01538:Grik3 APN 4 125694036 missense possibly damaging 0.90
IGL02276:Grik3 APN 4 125623502 missense possibly damaging 0.86
IGL02323:Grik3 APN 4 125685990 splice site probably benign
IGL02475:Grik3 APN 4 125650517 missense probably benign
IGL03198:Grik3 APN 4 125659762 missense probably benign 0.25
IGL03307:Grik3 APN 4 125641554 missense possibly damaging 0.91
R0054:Grik3 UTSW 4 125623575 missense probably damaging 1.00
R0054:Grik3 UTSW 4 125623575 missense probably damaging 1.00
R0116:Grik3 UTSW 4 125670556 missense probably benign 0.01
R0208:Grik3 UTSW 4 125686165 missense probably damaging 1.00
R0497:Grik3 UTSW 4 125623510 missense possibly damaging 0.82
R1295:Grik3 UTSW 4 125704564 splice site probably benign
R1296:Grik3 UTSW 4 125704564 splice site probably benign
R1515:Grik3 UTSW 4 125670728 missense probably benign 0.37
R1559:Grik3 UTSW 4 125707997 missense probably benign 0.16
R1617:Grik3 UTSW 4 125691192 missense probably benign
R1848:Grik3 UTSW 4 125694138 missense probably damaging 1.00
R2903:Grik3 UTSW 4 125670644 missense probably damaging 1.00
R3440:Grik3 UTSW 4 125693970 missense probably damaging 1.00
R3440:Grik3 UTSW 4 125693971 missense probably damaging 1.00
R3442:Grik3 UTSW 4 125693970 missense probably damaging 1.00
R3442:Grik3 UTSW 4 125693971 missense probably damaging 1.00
R3842:Grik3 UTSW 4 125693954 splice site probably benign
R4649:Grik3 UTSW 4 125650485 missense probably damaging 1.00
R4841:Grik3 UTSW 4 125691176 missense probably damaging 1.00
R4842:Grik3 UTSW 4 125691176 missense probably damaging 1.00
R5093:Grik3 UTSW 4 125670589 missense probably benign
R5318:Grik3 UTSW 4 125694136 missense probably damaging 0.96
R5549:Grik3 UTSW 4 125686045 missense possibly damaging 0.95
R6221:Grik3 UTSW 4 125705123 missense probably damaging 0.99
R6226:Grik3 UTSW 4 125659789 missense probably benign 0.04
R6306:Grik3 UTSW 4 125632412 missense probably benign 0.01
R6672:Grik3 UTSW 4 125623516 missense probably benign 0.08
R6682:Grik3 UTSW 4 125650466 missense probably damaging 1.00
R6783:Grik3 UTSW 4 125632300 missense probably benign 0.01
R7390:Grik3 UTSW 4 125649739 missense probably damaging 1.00
R7604:Grik3 UTSW 4 125623635 missense probably damaging 0.97
R7790:Grik3 UTSW 4 125686019 missense probably damaging 1.00
R7822:Grik3 UTSW 4 125656397 critical splice donor site probably null
R7952:Grik3 UTSW 4 125704547 missense probably damaging 1.00
R8769:Grik3 UTSW 4 125656373 missense probably damaging 1.00
R9030:Grik3 UTSW 4 125632392 missense probably benign 0.24
R9243:Grik3 UTSW 4 125707897 missense probably benign 0.00
Z1177:Grik3 UTSW 4 125650506 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TCCATGTTGACGTTGAACTGC -3'
(R):5'- TACCTGGCGATGACGAAGAG -3'

Sequencing Primer
(F):5'- CACTTAATGATCCCAGTGCTGAGG -3'
(R):5'- GGACACAGCTGACACCCAGG -3'
Posted On 2020-10-20