Incidental Mutation 'R8418:BC005561'
ID653031
Institutional Source Beutler Lab
Gene Symbol BC005561
Ensembl Gene ENSMUSG00000079065
Gene NamecDNA sequence BC005561
Synonyms
Accession Numbers

Genbank: NM_001166581; MGI: 3040669

Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock #R8418 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location104508352-104522611 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 104519858 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 749 (Q749K)
Ref Sequence ENSEMBL: ENSMUSP00000130629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096452]
Predicted Effect possibly damaging
Transcript: ENSMUST00000096452
AA Change: Q749K

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000130629
Gene: ENSMUSG00000079065
AA Change: Q749K

DomainStartEndE-ValueType
Pfam:THOC2_N 10 424 3.5e-65 PFAM
Pfam:THOC2_N 415 566 5.8e-32 PFAM
Pfam:Thoc2 568 643 8.3e-40 PFAM
low complexity region 729 747 N/A INTRINSIC
Pfam:Tho2 873 1173 1.1e-105 PFAM
low complexity region 1251 1262 N/A INTRINSIC
low complexity region 1266 1283 N/A INTRINSIC
coiled coil region 1310 1335 N/A INTRINSIC
low complexity region 1355 1366 N/A INTRINSIC
low complexity region 1459 1482 N/A INTRINSIC
low complexity region 1524 1543 N/A INTRINSIC
low complexity region 1561 1569 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf2 T C 17: 42,710,586 H449R probably benign Het
Arfgef2 T C 2: 166,856,548 V646A probably benign Het
Bean1 CT C 8: 104,182,032 probably null Het
Ccdc155 A G 7: 45,194,077 L241P probably damaging Het
Ccdc62 C T 5: 123,946,392 R279* probably null Het
Col6a5 G T 9: 105,878,622 P2201Q probably damaging Het
Cpa3 T C 3: 20,222,151 Y306C probably damaging Het
Cpne9 A G 6: 113,283,437 N82D possibly damaging Het
Dcaf17 T A 2: 71,088,373 D430E probably damaging Het
Dcst2 T C 3: 89,371,594 V546A probably benign Het
Dennd1a T C 2: 37,858,391 T359A probably benign Het
Dgkb C A 12: 38,330,017 H591N probably damaging Het
Dnah17 G A 11: 118,103,458 S1047F probably benign Het
Dock2 A G 11: 34,718,968 I215T probably benign Het
Efcab12 A G 6: 115,822,115 probably null Het
Erich3 C T 3: 154,709,741 R165C Het
Fam166b A G 4: 43,427,204 L76P unknown Het
Gabrr1 C T 4: 33,162,615 R394* probably null Het
Garnl3 G T 2: 33,052,146 Q153K possibly damaging Het
Gars A G 6: 55,065,461 N393S probably damaging Het
Gbp2b A T 3: 142,603,705 E192D probably benign Het
Gm28360 A T 1: 117,853,627 H116L probably benign Het
Gp1bb T A 16: 18,621,353 H5L unknown Het
Grik3 A G 4: 125,686,042 K527E possibly damaging Het
Hhip T C 8: 80,045,085 M199V probably damaging Het
Irgm1 A G 11: 48,866,339 V231A probably damaging Het
Itgal A T 7: 127,330,282 I1124F probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Miga1 T G 3: 152,285,317 Y433S probably damaging Het
Muc16 A T 9: 18,519,630 I8062K possibly damaging Het
Ntsr2 T G 12: 16,656,661 V230G possibly damaging Het
Olfr597 A G 7: 103,321,071 Y220C Het
Ptpn2 G A 18: 67,681,522 T139M probably damaging Het
Pum2 T A 12: 8,710,245 D145E possibly damaging Het
Radil T C 5: 142,494,921 E593G probably benign Het
Rdh14 T C 12: 10,394,580 F144L probably damaging Het
Sec23ip T G 7: 128,778,463 D867E probably damaging Het
Serpina6 T C 12: 103,646,928 Y371C probably damaging Het
Snx13 T A 12: 35,098,234 I254N probably damaging Het
Tacc1 T C 8: 25,241,516 K7E probably damaging Het
Timeless A C 10: 128,250,736 N1048T probably benign Het
Tll2 C A 19: 41,092,837 E732D probably damaging Het
Tmem171 A G 13: 98,692,232 S137P probably damaging Het
Ttll3 A T 6: 113,394,773 M44L probably benign Het
Vmn2r29 T A 7: 7,241,940 I312L probably benign Het
Vmn2r43 A T 7: 8,255,584 L210* probably null Het
Vmn2r60 A G 7: 42,195,426 I738V probably damaging Het
Zfp977 T A 7: 42,579,986 M372L probably benign Het
Other mutations in BC005561
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:BC005561 APN 5 104520500 missense probably damaging 1.00
IGL01024:BC005561 APN 5 104521746 missense probably benign 0.02
IGL01133:BC005561 APN 5 104517662 missense probably benign
IGL01564:BC005561 APN 5 104520663 missense probably benign 0.12
IGL01727:BC005561 APN 5 104519513 missense probably benign 0.01
IGL02086:BC005561 APN 5 104519001 missense possibly damaging 0.49
IGL02153:BC005561 APN 5 104521083 missense probably benign 0.02
IGL02256:BC005561 APN 5 104520283 nonsense probably null
IGL02436:BC005561 APN 5 104521155 missense probably benign 0.10
IGL02969:BC005561 APN 5 104519343 missense probably benign 0.01
IGL03275:BC005561 APN 5 104518277 missense probably benign 0.00
IGL03357:BC005561 APN 5 104520468 missense probably damaging 1.00
Magnetar UTSW 5 104520279 missense probably damaging 0.99
F2404:BC005561 UTSW 5 104520230 missense possibly damaging 0.83
R0318:BC005561 UTSW 5 104517753 missense probably benign 0.00
R0349:BC005561 UTSW 5 104519976 missense possibly damaging 0.85
R0454:BC005561 UTSW 5 104518211 missense probably benign 0.45
R0742:BC005561 UTSW 5 104522154 missense probably benign 0.00
R0842:BC005561 UTSW 5 104519200 missense possibly damaging 0.81
R0882:BC005561 UTSW 5 104519009 missense probably benign 0.05
R1123:BC005561 UTSW 5 104518470 missense probably damaging 1.00
R1171:BC005561 UTSW 5 104520903 missense possibly damaging 0.49
R1205:BC005561 UTSW 5 104520213 missense probably benign 0.28
R1261:BC005561 UTSW 5 104520635 missense probably damaging 0.98
R1432:BC005561 UTSW 5 104518104 missense probably damaging 1.00
R1447:BC005561 UTSW 5 104522204 missense possibly damaging 0.89
R1466:BC005561 UTSW 5 104518257 missense probably damaging 0.99
R1466:BC005561 UTSW 5 104518257 missense probably damaging 0.99
R1584:BC005561 UTSW 5 104518257 missense probably damaging 0.99
R1636:BC005561 UTSW 5 104520750 missense probably damaging 0.99
R1686:BC005561 UTSW 5 104519923 nonsense probably null
R1698:BC005561 UTSW 5 104520510 missense probably benign 0.09
R1816:BC005561 UTSW 5 104517834 missense probably benign 0.16
R1903:BC005561 UTSW 5 104518330 missense probably benign 0.00
R2096:BC005561 UTSW 5 104519969 missense possibly damaging 0.95
R2146:BC005561 UTSW 5 104518991 missense probably benign
R2226:BC005561 UTSW 5 104519420 missense probably damaging 1.00
R2227:BC005561 UTSW 5 104519420 missense probably damaging 1.00
R2383:BC005561 UTSW 5 104518988 missense probably benign 0.23
R2656:BC005561 UTSW 5 104519315 missense probably benign 0.05
R3982:BC005561 UTSW 5 104521023 missense probably benign 0.29
R3983:BC005561 UTSW 5 104521023 missense probably benign 0.29
R4115:BC005561 UTSW 5 104519433 missense probably damaging 1.00
R4345:BC005561 UTSW 5 104521449 missense probably benign 0.21
R4697:BC005561 UTSW 5 104522240 missense probably benign 0.00
R4711:BC005561 UTSW 5 104519661 missense probably damaging 0.98
R4742:BC005561 UTSW 5 104518857 missense probably benign 0.17
R4758:BC005561 UTSW 5 104520399 missense possibly damaging 0.48
R4863:BC005561 UTSW 5 104517750 missense possibly damaging 0.89
R4867:BC005561 UTSW 5 104521002 missense possibly damaging 0.91
R5024:BC005561 UTSW 5 104522258 missense possibly damaging 0.68
R5114:BC005561 UTSW 5 104519876 missense probably damaging 0.99
R5117:BC005561 UTSW 5 104520255 missense probably damaging 1.00
R5289:BC005561 UTSW 5 104519657 missense probably benign 0.03
R5341:BC005561 UTSW 5 104518076 missense probably damaging 1.00
R5420:BC005561 UTSW 5 104518359 missense probably damaging 0.99
R5421:BC005561 UTSW 5 104518395 missense probably benign 0.01
R5422:BC005561 UTSW 5 104519646 missense probably damaging 0.98
R5606:BC005561 UTSW 5 104521878 missense probably benign 0.00
R5939:BC005561 UTSW 5 104519207 missense possibly damaging 0.56
R6104:BC005561 UTSW 5 104518218 missense probably damaging 1.00
R6169:BC005561 UTSW 5 104518396 missense probably benign 0.00
R6316:BC005561 UTSW 5 104519729 missense probably damaging 1.00
R6352:BC005561 UTSW 5 104520198 missense probably benign 0.11
R6408:BC005561 UTSW 5 104518777 missense probably benign 0.19
R6458:BC005561 UTSW 5 104522303 missense probably benign 0.02
R6722:BC005561 UTSW 5 104520279 missense probably damaging 0.99
R6789:BC005561 UTSW 5 104517689 missense probably benign 0.00
R7214:BC005561 UTSW 5 104522363 missense probably benign
R7494:BC005561 UTSW 5 104518418 missense possibly damaging 0.90
R7733:BC005561 UTSW 5 104519960 missense possibly damaging 0.82
R7884:BC005561 UTSW 5 104521346 missense possibly damaging 0.52
R7945:BC005561 UTSW 5 104518547 missense possibly damaging 0.93
R8112:BC005561 UTSW 5 104521635 missense probably benign
R8131:BC005561 UTSW 5 104521161 missense possibly damaging 0.95
Z1176:BC005561 UTSW 5 104520192 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- GGCAGGCAAAAGTTTTGATCTAC -3'
(R):5'- AATGCTGCATCATGGGGTG -3'

Sequencing Primer
(F):5'- TGGCAGGAATAGAAGTTACAGAG -3'
(R):5'- CTGCATCATGGGGTGTATGAAATTC -3'
Posted On2020-10-20