Incidental Mutation 'R8419:Prelp'
ID 653070
Institutional Source Beutler Lab
Gene Symbol Prelp
Ensembl Gene ENSMUSG00000041577
Gene Name proline arginine-rich end leucine-rich repeat
Synonyms 7330409J17Rik, SLRR2A
MMRRC Submission 067772-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8419 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 133910304-133921414 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 133915282 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 42 (F42L)
Ref Sequence ENSEMBL: ENSMUSP00000048803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048432]
AlphaFold Q9JK53
Predicted Effect probably benign
Transcript: ENSMUST00000048432
AA Change: F42L

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000048803
Gene: ENSMUSG00000041577
AA Change: F42L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 23 63 N/A INTRINSIC
LRRNT 68 102 5.86e-11 SMART
LRR 98 120 3.27e1 SMART
LRR 122 144 1.37e2 SMART
LRR 145 168 2.14e0 SMART
LRR 169 189 4.97e0 SMART
LRR 190 215 2.47e1 SMART
LRR 216 239 9.75e0 SMART
LRR 241 260 2.15e2 SMART
LRR 286 309 1.53e1 SMART
Blast:LRR 345 369 3e-7 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a leucine-rich repeat protein present in connective tissue extracellular matrix. This protein functions as a molecule anchoring basement membranes to the underlying connective tissue. This protein has been shown to bind type I collagen to basement membranes and type II collagen to cartilage. It also binds the basement membrane heparan sulfate proteoglycan perlecan. This protein is suggested to be involved in the pathogenesis of Hutchinson-Gilford progeria (HGP), which is reported to lack the binding of collagen in basement membranes and cartilage. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik G T 7: 28,143,921 (GRCm38) G745C probably damaging Het
9930111J21Rik2 A T 11: 49,019,485 (GRCm38) I707N probably damaging Het
Abca14 A G 7: 120,216,266 (GRCm38) I246V probably benign Het
Adam19 G A 11: 46,125,023 (GRCm38) A337T possibly damaging Het
Ankrd40 G T 11: 94,334,836 (GRCm38) G231V probably damaging Het
Arhgap5 G A 12: 52,518,789 (GRCm38) V848I probably damaging Het
Bmpr2 G A 1: 59,867,356 (GRCm38) R536H probably damaging Het
Casz1 T A 4: 148,948,583 (GRCm38) S1310T probably benign Het
Chil1 A T 1: 134,189,542 (GRCm38) D367V probably damaging Het
Cltc A G 11: 86,707,566 (GRCm38) V990A probably benign Het
Col6a3 A T 1: 90,802,213 (GRCm38) S1790R probably damaging Het
Comt C T 16: 18,411,887 (GRCm38) W24* probably null Het
Cyp2c70 T C 19: 40,160,580 (GRCm38) E374G possibly damaging Het
Dach1 T C 14: 98,168,640 (GRCm38) T224A probably damaging Het
Dapk1 G A 13: 60,740,097 (GRCm38) E656K probably benign Het
Dicer1 A G 12: 104,702,677 (GRCm38) S1249P probably benign Het
Dpp8 A C 9: 65,080,755 (GRCm38) I861L probably benign Het
Enam C T 5: 88,503,350 (GRCm38) S906L possibly damaging Het
Eral1 A T 11: 78,074,080 (GRCm38) I429N possibly damaging Het
Fbxo10 C A 4: 45,041,809 (GRCm38) G807C possibly damaging Het
Fsip2 G C 2: 82,978,619 (GRCm38) E1761Q probably damaging Het
Ggnbp2 C T 11: 84,837,989 (GRCm38) probably null Het
Gm10696 T C 3: 94,175,614 (GRCm38) I297V probably benign Het
Gm13088 A G 4: 143,656,427 (GRCm38) I74T probably damaging Het
Gm4353 G A 7: 116,083,549 (GRCm38) P266S probably benign Het
Gpr84 T C 15: 103,309,536 (GRCm38) N38S probably damaging Het
Guca1a A T 17: 47,395,555 (GRCm38) I115N probably damaging Het
Hic1 C T 11: 75,166,270 (GRCm38) V598M possibly damaging Het
Itga1 A T 13: 115,007,068 (GRCm38) I309N probably damaging Het
Itga11 T C 9: 62,755,178 (GRCm38) S478P possibly damaging Het
Kctd8 T C 5: 69,340,370 (GRCm38) D311G probably damaging Het
Klhl32 T C 4: 24,682,203 (GRCm38) E127G possibly damaging Het
Lama2 T A 10: 27,422,563 (GRCm38) Y179F probably benign Het
Lamb2 G T 9: 108,488,364 (GRCm38) R1382L probably benign Het
Mrpl1 C G 5: 96,226,367 (GRCm38) A167G probably benign Het
Muc3 A T 5: 137,146,722 (GRCm38) N33K Het
Myt1 A T 2: 181,782,606 (GRCm38) R31* probably null Het
Nectin2 A T 7: 19,738,078 (GRCm38) Y129N probably damaging Het
Nectin2 T C 7: 19,717,721 (GRCm38) T463A probably benign Het
Olfr103 A G 17: 37,336,575 (GRCm38) I219T possibly damaging Het
Olfr1297 A T 2: 111,621,504 (GRCm38) M190K probably benign Het
Papolb T A 5: 142,528,541 (GRCm38) N449I possibly damaging Het
Parn T C 16: 13,648,474 (GRCm38) K236R probably benign Het
Prelid1 G A 13: 55,322,885 (GRCm38) R42Q probably damaging Het
Pygo1 C T 9: 72,945,098 (GRCm38) P189L probably damaging Het
Rimbp3 T A 16: 17,213,022 (GRCm38) S1437T probably damaging Het
Slc37a2 T A 9: 37,237,430 (GRCm38) D252V probably benign Het
Socs7 A G 11: 97,363,339 (GRCm38) K233R probably benign Het
Stat4 A G 1: 52,098,478 (GRCm38) D476G possibly damaging Het
Tesmin A G 19: 3,389,077 (GRCm38) D43G probably benign Het
Thap1 C A 8: 26,158,474 (GRCm38) Y8* probably null Het
Tln1 A G 4: 43,536,397 (GRCm38) L1965P probably damaging Het
Tmprss11d A G 5: 86,309,306 (GRCm38) S303P probably damaging Het
Tomm40 C T 7: 19,701,834 (GRCm38) V324M probably damaging Het
Vmn1r202 A T 13: 22,501,815 (GRCm38) I144K probably damaging Het
Other mutations in Prelp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Prelp APN 1 133,914,807 (GRCm38) missense probably benign 0.03
IGL02869:Prelp APN 1 133,915,267 (GRCm38) nonsense probably null
PIT4576001:Prelp UTSW 1 133,915,165 (GRCm38) missense possibly damaging 0.78
R0972:Prelp UTSW 1 133,914,676 (GRCm38) missense probably damaging 0.99
R1728:Prelp UTSW 1 133,915,131 (GRCm38) missense probably benign
R1729:Prelp UTSW 1 133,915,131 (GRCm38) missense probably benign
R1730:Prelp UTSW 1 133,915,131 (GRCm38) missense probably benign
R1739:Prelp UTSW 1 133,915,131 (GRCm38) missense probably benign
R1762:Prelp UTSW 1 133,915,131 (GRCm38) missense probably benign
R1783:Prelp UTSW 1 133,915,131 (GRCm38) missense probably benign
R1784:Prelp UTSW 1 133,915,131 (GRCm38) missense probably benign
R1785:Prelp UTSW 1 133,915,131 (GRCm38) missense probably benign
R1843:Prelp UTSW 1 133,914,757 (GRCm38) missense probably damaging 0.99
R2049:Prelp UTSW 1 133,915,131 (GRCm38) missense probably benign
R2130:Prelp UTSW 1 133,915,131 (GRCm38) missense probably benign
R2131:Prelp UTSW 1 133,915,131 (GRCm38) missense probably benign
R2133:Prelp UTSW 1 133,915,131 (GRCm38) missense probably benign
R2141:Prelp UTSW 1 133,915,131 (GRCm38) missense probably benign
R2142:Prelp UTSW 1 133,915,131 (GRCm38) missense probably benign
R4694:Prelp UTSW 1 133,914,747 (GRCm38) missense probably damaging 0.96
R6398:Prelp UTSW 1 133,914,741 (GRCm38) missense probably damaging 1.00
R6415:Prelp UTSW 1 133,914,657 (GRCm38) missense probably damaging 1.00
R6415:Prelp UTSW 1 133,912,778 (GRCm38) missense probably benign 0.38
R6678:Prelp UTSW 1 133,914,775 (GRCm38) missense probably benign 0.00
R6767:Prelp UTSW 1 133,912,710 (GRCm38) missense probably benign 0.02
R7644:Prelp UTSW 1 133,914,618 (GRCm38) missense probably benign 0.16
R7834:Prelp UTSW 1 133,914,772 (GRCm38) missense probably damaging 0.96
R8819:Prelp UTSW 1 133,915,140 (GRCm38) missense probably damaging 0.98
R8820:Prelp UTSW 1 133,915,140 (GRCm38) missense probably damaging 0.98
R9034:Prelp UTSW 1 133,914,591 (GRCm38) missense probably damaging 1.00
R9300:Prelp UTSW 1 133,914,519 (GRCm38) missense probably damaging 1.00
R9617:Prelp UTSW 1 133,914,678 (GRCm38) missense probably damaging 1.00
X0066:Prelp UTSW 1 133,915,276 (GRCm38) missense probably benign 0.00
Z1176:Prelp UTSW 1 133,914,881 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGAGGAAGCTCAGTGATG -3'
(R):5'- ACGCACCTTTCCACAAGAGG -3'

Sequencing Primer
(F):5'- CTCAGTGATGAAGTTGTTCTGCAAG -3'
(R):5'- GAGGCTAAACTCCCAGTCTC -3'
Posted On 2020-10-20