Incidental Mutation 'R8419:Tln1'
ID 653077
Institutional Source Beutler Lab
Gene Symbol Tln1
Ensembl Gene ENSMUSG00000028465
Gene Name talin 1
Synonyms
MMRRC Submission 067772-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8419 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 43531519-43562691 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 43536397 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 1965 (L1965P)
Ref Sequence ENSEMBL: ENSMUSP00000030187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030187]
AlphaFold P26039
PDB Structure Crystal Structure of Talin Rod 482-655 [X-RAY DIFFRACTION]
Crystal Structure of talin residues 482-789 [X-RAY DIFFRACTION]
Vinculin complexed with the VBS1 helix from talin [X-RAY DIFFRACTION]
Solution structure of VBS2 fragment of talin [SOLUTION NMR]
Structural basis for phosphatidylinositol phosphate kinase type I-gamma binding to talin at focal adhesions [X-RAY DIFFRACTION]
Vinculin Head (0-258) in Complex with the Talin Rod residues 1630-1652 [X-RAY DIFFRACTION]
Solution structure of VBS3 fragment of talin [SOLUTION NMR]
NMR structure of talin-PTB in complex with PIPKI [SOLUTION NMR]
NMR structure of the talin C-terminal actin binding site [SOLUTION NMR]
NMR structure of the talin rod domain, 1655-1822 [SOLUTION NMR]
>> 16 additional structures at PDB <<
Predicted Effect probably damaging
Transcript: ENSMUST00000030187
AA Change: L1965P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030187
Gene: ENSMUSG00000028465
AA Change: L1965P

DomainStartEndE-ValueType
Blast:B41 2 76 5e-31 BLAST
B41 82 313 4.66e-73 SMART
IRS 308 401 7.65e-16 SMART
Pfam:Talin_middle 491 652 8.2e-60 PFAM
low complexity region 671 690 N/A INTRINSIC
internal_repeat_2 699 760 8.94e-6 PROSPERO
low complexity region 766 775 N/A INTRINSIC
PDB:1ZVZ|B 820 844 2e-7 PDB
low complexity region 866 879 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
PDB:2LQG|A 913 1044 2e-44 PDB
PDB:2L7N|A 1046 1207 1e-101 PDB
Pfam:VBS 1234 1358 9.6e-8 PFAM
internal_repeat_2 1488 1549 8.94e-6 PROSPERO
internal_repeat_3 1623 1769 4.92e-5 PROSPERO
low complexity region 1817 1828 N/A INTRINSIC
Pfam:VBS 1849 1973 6.2e-67 PFAM
PDB:3DYJ|B 1974 2293 N/A PDB
low complexity region 2305 2327 N/A INTRINSIC
ILWEQ 2336 2533 2.93e-105 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein that is concentrated in areas of cell-substratum and cell-cell contacts. The encoded protein plays a significant role in the assembly of actin filaments and in spreading and migration of various cell types, including fibroblasts and osteoclasts. It codistributes with integrins in the cell surface membrane in order to assist in the attachment of adherent cells to extracellular matrices and of lymphocytes to other cells. The N-terminus of this protein contains elements for localization to cell-extracellular matrix junctions. The C-terminus contains binding sites for proteins such as beta-1-integrin, actin, and vinculin. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for either one of two knock-out alleles display early developmental anomalies, reduced embryo size, and embryonic lethality due to impaired cell migration at the gastrulation stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik G T 7: 28,143,921 (GRCm38) G745C probably damaging Het
9930111J21Rik2 A T 11: 49,019,485 (GRCm38) I707N probably damaging Het
Abca14 A G 7: 120,216,266 (GRCm38) I246V probably benign Het
Adam19 G A 11: 46,125,023 (GRCm38) A337T possibly damaging Het
Ankrd40 G T 11: 94,334,836 (GRCm38) G231V probably damaging Het
Arhgap5 G A 12: 52,518,789 (GRCm38) V848I probably damaging Het
Bmpr2 G A 1: 59,867,356 (GRCm38) R536H probably damaging Het
Casz1 T A 4: 148,948,583 (GRCm38) S1310T probably benign Het
Chil1 A T 1: 134,189,542 (GRCm38) D367V probably damaging Het
Cltc A G 11: 86,707,566 (GRCm38) V990A probably benign Het
Col6a3 A T 1: 90,802,213 (GRCm38) S1790R probably damaging Het
Comt C T 16: 18,411,887 (GRCm38) W24* probably null Het
Cyp2c70 T C 19: 40,160,580 (GRCm38) E374G possibly damaging Het
Dach1 T C 14: 98,168,640 (GRCm38) T224A probably damaging Het
Dapk1 G A 13: 60,740,097 (GRCm38) E656K probably benign Het
Dicer1 A G 12: 104,702,677 (GRCm38) S1249P probably benign Het
Dpp8 A C 9: 65,080,755 (GRCm38) I861L probably benign Het
Enam C T 5: 88,503,350 (GRCm38) S906L possibly damaging Het
Eral1 A T 11: 78,074,080 (GRCm38) I429N possibly damaging Het
Fbxo10 C A 4: 45,041,809 (GRCm38) G807C possibly damaging Het
Fsip2 G C 2: 82,978,619 (GRCm38) E1761Q probably damaging Het
Ggnbp2 C T 11: 84,837,989 (GRCm38) probably null Het
Gm10696 T C 3: 94,175,614 (GRCm38) I297V probably benign Het
Gm13088 A G 4: 143,656,427 (GRCm38) I74T probably damaging Het
Gm4353 G A 7: 116,083,549 (GRCm38) P266S probably benign Het
Gpr84 T C 15: 103,309,536 (GRCm38) N38S probably damaging Het
Guca1a A T 17: 47,395,555 (GRCm38) I115N probably damaging Het
Hic1 C T 11: 75,166,270 (GRCm38) V598M possibly damaging Het
Itga1 A T 13: 115,007,068 (GRCm38) I309N probably damaging Het
Itga11 T C 9: 62,755,178 (GRCm38) S478P possibly damaging Het
Kctd8 T C 5: 69,340,370 (GRCm38) D311G probably damaging Het
Klhl32 T C 4: 24,682,203 (GRCm38) E127G possibly damaging Het
Lama2 T A 10: 27,422,563 (GRCm38) Y179F probably benign Het
Lamb2 G T 9: 108,488,364 (GRCm38) R1382L probably benign Het
Mrpl1 C G 5: 96,226,367 (GRCm38) A167G probably benign Het
Muc3 A T 5: 137,146,722 (GRCm38) N33K Het
Myt1 A T 2: 181,782,606 (GRCm38) R31* probably null Het
Nectin2 T C 7: 19,717,721 (GRCm38) T463A probably benign Het
Nectin2 A T 7: 19,738,078 (GRCm38) Y129N probably damaging Het
Olfr103 A G 17: 37,336,575 (GRCm38) I219T possibly damaging Het
Olfr1297 A T 2: 111,621,504 (GRCm38) M190K probably benign Het
Papolb T A 5: 142,528,541 (GRCm38) N449I possibly damaging Het
Parn T C 16: 13,648,474 (GRCm38) K236R probably benign Het
Prelid1 G A 13: 55,322,885 (GRCm38) R42Q probably damaging Het
Prelp A G 1: 133,915,282 (GRCm38) F42L probably benign Het
Pygo1 C T 9: 72,945,098 (GRCm38) P189L probably damaging Het
Rimbp3 T A 16: 17,213,022 (GRCm38) S1437T probably damaging Het
Slc37a2 T A 9: 37,237,430 (GRCm38) D252V probably benign Het
Socs7 A G 11: 97,363,339 (GRCm38) K233R probably benign Het
Stat4 A G 1: 52,098,478 (GRCm38) D476G possibly damaging Het
Tesmin A G 19: 3,389,077 (GRCm38) D43G probably benign Het
Thap1 C A 8: 26,158,474 (GRCm38) Y8* probably null Het
Tmprss11d A G 5: 86,309,306 (GRCm38) S303P probably damaging Het
Tomm40 C T 7: 19,701,834 (GRCm38) V324M probably damaging Het
Vmn1r202 A T 13: 22,501,815 (GRCm38) I144K probably damaging Het
Other mutations in Tln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Tln1 APN 4 43,542,719 (GRCm38) missense probably benign 0.22
IGL00987:Tln1 APN 4 43,551,297 (GRCm38) unclassified probably benign
IGL01345:Tln1 APN 4 43,536,281 (GRCm38) missense probably damaging 1.00
IGL01456:Tln1 APN 4 43,543,432 (GRCm38) unclassified probably benign
IGL01715:Tln1 APN 4 43,555,890 (GRCm38) missense probably damaging 1.00
IGL01750:Tln1 APN 4 43,545,435 (GRCm38) missense probably damaging 1.00
IGL01933:Tln1 APN 4 43,555,894 (GRCm38) missense possibly damaging 0.52
IGL01933:Tln1 APN 4 43,539,508 (GRCm38) missense probably benign
IGL02119:Tln1 APN 4 43,546,760 (GRCm38) missense probably damaging 0.99
IGL02148:Tln1 APN 4 43,555,388 (GRCm38) missense probably damaging 1.00
IGL02153:Tln1 APN 4 43,546,857 (GRCm38) missense possibly damaging 0.76
IGL02522:Tln1 APN 4 43,540,612 (GRCm38) missense probably benign 0.07
IGL02691:Tln1 APN 4 43,539,544 (GRCm38) missense probably benign 0.42
IGL02882:Tln1 APN 4 43,539,522 (GRCm38) missense probably benign 0.45
IGL02892:Tln1 APN 4 43,555,679 (GRCm38) missense probably damaging 1.00
IGL03061:Tln1 APN 4 43,545,694 (GRCm38) missense probably damaging 1.00
IGL03102:Tln1 APN 4 43,532,861 (GRCm38) missense possibly damaging 0.89
IGL03183:Tln1 APN 4 43,539,084 (GRCm38) splice site probably benign
H8786:Tln1 UTSW 4 43,544,589 (GRCm38) missense probably damaging 0.97
PIT4576001:Tln1 UTSW 4 43,539,998 (GRCm38) missense probably damaging 1.00
PIT4696001:Tln1 UTSW 4 43,542,701 (GRCm38) critical splice donor site probably null
R0206:Tln1 UTSW 4 43,549,151 (GRCm38) missense probably damaging 1.00
R0208:Tln1 UTSW 4 43,549,151 (GRCm38) missense probably damaging 1.00
R0454:Tln1 UTSW 4 43,553,504 (GRCm38) missense probably benign
R0539:Tln1 UTSW 4 43,543,434 (GRCm38) critical splice donor site probably null
R0548:Tln1 UTSW 4 43,542,709 (GRCm38) missense possibly damaging 0.79
R0561:Tln1 UTSW 4 43,550,304 (GRCm38) missense possibly damaging 0.94
R0606:Tln1 UTSW 4 43,547,756 (GRCm38) missense probably benign 0.34
R0607:Tln1 UTSW 4 43,553,071 (GRCm38) missense probably damaging 1.00
R0609:Tln1 UTSW 4 43,544,645 (GRCm38) missense possibly damaging 0.63
R0847:Tln1 UTSW 4 43,555,333 (GRCm38) missense probably damaging 1.00
R0993:Tln1 UTSW 4 43,549,825 (GRCm38) missense probably benign 0.22
R1255:Tln1 UTSW 4 43,538,044 (GRCm38) missense probably damaging 1.00
R1292:Tln1 UTSW 4 43,534,578 (GRCm38) critical splice donor site probably null
R1752:Tln1 UTSW 4 43,536,311 (GRCm38) missense probably damaging 1.00
R2169:Tln1 UTSW 4 43,548,005 (GRCm38) missense probably damaging 1.00
R2172:Tln1 UTSW 4 43,545,721 (GRCm38) missense probably benign
R2202:Tln1 UTSW 4 43,553,083 (GRCm38) splice site probably null
R2680:Tln1 UTSW 4 43,539,668 (GRCm38) missense probably damaging 1.00
R3012:Tln1 UTSW 4 43,542,525 (GRCm38) missense probably benign
R3714:Tln1 UTSW 4 43,540,597 (GRCm38) missense probably damaging 1.00
R3735:Tln1 UTSW 4 43,549,370 (GRCm38) missense probably damaging 0.97
R3794:Tln1 UTSW 4 43,536,295 (GRCm38) missense probably damaging 1.00
R3825:Tln1 UTSW 4 43,536,413 (GRCm38) splice site probably benign
R3983:Tln1 UTSW 4 43,553,030 (GRCm38) missense probably damaging 1.00
R4061:Tln1 UTSW 4 43,549,177 (GRCm38) missense probably damaging 1.00
R4249:Tln1 UTSW 4 43,536,104 (GRCm38) missense probably damaging 1.00
R4287:Tln1 UTSW 4 43,543,509 (GRCm38) missense probably benign 0.01
R4471:Tln1 UTSW 4 43,551,018 (GRCm38) missense probably benign 0.03
R4562:Tln1 UTSW 4 43,533,598 (GRCm38) missense probably damaging 1.00
R4654:Tln1 UTSW 4 43,535,954 (GRCm38) missense probably null 1.00
R4737:Tln1 UTSW 4 43,540,588 (GRCm38) missense probably benign 0.00
R4936:Tln1 UTSW 4 43,547,522 (GRCm38) missense possibly damaging 0.83
R5225:Tln1 UTSW 4 43,539,406 (GRCm38) missense probably benign 0.06
R5288:Tln1 UTSW 4 43,540,661 (GRCm38) missense probably benign 0.06
R5421:Tln1 UTSW 4 43,533,609 (GRCm38) missense possibly damaging 0.80
R5445:Tln1 UTSW 4 43,543,905 (GRCm38) missense probably benign 0.26
R5660:Tln1 UTSW 4 43,547,732 (GRCm38) missense probably damaging 1.00
R5772:Tln1 UTSW 4 43,545,191 (GRCm38) missense probably benign 0.13
R6012:Tln1 UTSW 4 43,539,508 (GRCm38) missense probably benign
R6038:Tln1 UTSW 4 43,555,052 (GRCm38) missense probably damaging 0.99
R6038:Tln1 UTSW 4 43,555,052 (GRCm38) missense probably damaging 0.99
R6039:Tln1 UTSW 4 43,555,052 (GRCm38) missense probably damaging 0.99
R6039:Tln1 UTSW 4 43,555,052 (GRCm38) missense probably damaging 0.99
R6052:Tln1 UTSW 4 43,555,052 (GRCm38) missense probably damaging 0.99
R6145:Tln1 UTSW 4 43,538,030 (GRCm38) missense possibly damaging 0.64
R6157:Tln1 UTSW 4 43,534,744 (GRCm38) missense probably benign 0.06
R6242:Tln1 UTSW 4 43,533,145 (GRCm38) missense probably damaging 1.00
R6454:Tln1 UTSW 4 43,533,866 (GRCm38) missense probably damaging 0.99
R6467:Tln1 UTSW 4 43,543,165 (GRCm38) missense probably benign 0.42
R6548:Tln1 UTSW 4 43,547,525 (GRCm38) missense probably damaging 0.98
R6576:Tln1 UTSW 4 43,555,419 (GRCm38) splice site probably null
R6722:Tln1 UTSW 4 43,547,618 (GRCm38) missense probably damaging 1.00
R6968:Tln1 UTSW 4 43,550,217 (GRCm38) missense probably benign 0.02
R7000:Tln1 UTSW 4 43,556,302 (GRCm38) missense probably damaging 0.96
R7137:Tln1 UTSW 4 43,540,616 (GRCm38) missense probably damaging 1.00
R7242:Tln1 UTSW 4 43,542,602 (GRCm38) missense probably benign 0.01
R7294:Tln1 UTSW 4 43,534,399 (GRCm38) missense probably benign 0.02
R7312:Tln1 UTSW 4 43,545,922 (GRCm38) missense probably damaging 1.00
R7547:Tln1 UTSW 4 43,545,206 (GRCm38) missense possibly damaging 0.80
R7836:Tln1 UTSW 4 43,554,309 (GRCm38) missense probably benign 0.01
R7874:Tln1 UTSW 4 43,555,606 (GRCm38) missense probably damaging 1.00
R7874:Tln1 UTSW 4 43,538,041 (GRCm38) missense probably damaging 1.00
R8030:Tln1 UTSW 4 43,535,737 (GRCm38) critical splice donor site probably null
R8105:Tln1 UTSW 4 43,538,231 (GRCm38) missense probably benign 0.32
R8212:Tln1 UTSW 4 43,555,918 (GRCm38) missense probably damaging 1.00
R8416:Tln1 UTSW 4 43,540,116 (GRCm38) missense probably benign 0.01
R8680:Tln1 UTSW 4 43,553,041 (GRCm38) missense possibly damaging 0.52
R8708:Tln1 UTSW 4 43,534,769 (GRCm38) splice site probably benign
R8725:Tln1 UTSW 4 43,555,911 (GRCm38) missense possibly damaging 0.94
R8727:Tln1 UTSW 4 43,555,911 (GRCm38) missense possibly damaging 0.94
R8830:Tln1 UTSW 4 43,556,383 (GRCm38) missense probably benign
R8865:Tln1 UTSW 4 43,538,281 (GRCm38) missense possibly damaging 0.93
R9049:Tln1 UTSW 4 43,549,786 (GRCm38) nonsense probably null
R9050:Tln1 UTSW 4 43,549,786 (GRCm38) nonsense probably null
R9145:Tln1 UTSW 4 43,536,024 (GRCm38) missense probably damaging 1.00
R9210:Tln1 UTSW 4 43,536,119 (GRCm38) missense probably damaging 1.00
R9337:Tln1 UTSW 4 43,532,927 (GRCm38) missense probably damaging 1.00
R9346:Tln1 UTSW 4 43,546,895 (GRCm38) missense probably damaging 0.97
R9358:Tln1 UTSW 4 43,532,084 (GRCm38) missense possibly damaging 0.68
R9487:Tln1 UTSW 4 43,542,893 (GRCm38) missense probably damaging 1.00
R9631:Tln1 UTSW 4 43,545,694 (GRCm38) missense probably damaging 1.00
R9650:Tln1 UTSW 4 43,545,912 (GRCm38) missense probably damaging 1.00
R9666:Tln1 UTSW 4 43,542,957 (GRCm38) missense probably damaging 0.96
RF021:Tln1 UTSW 4 43,555,890 (GRCm38) missense probably damaging 1.00
X0052:Tln1 UTSW 4 43,533,125 (GRCm38) critical splice donor site probably null
X0063:Tln1 UTSW 4 43,548,015 (GRCm38) nonsense probably null
Z1176:Tln1 UTSW 4 43,543,211 (GRCm38) missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- GTCAGCTTTCCTCAAGAGTCC -3'
(R):5'- GTCTACACCAAGAAGGAGCTC -3'

Sequencing Primer
(F):5'- AGCCCAGTCTTCCTTGGG -3'
(R):5'- AGGAGCTCATAGAGTGTGCCC -3'
Posted On 2020-10-20