Incidental Mutation 'R8419:Enam'
ID 653083
Institutional Source Beutler Lab
Gene Symbol Enam
Ensembl Gene ENSMUSG00000029286
Gene Name enamelin
Synonyms abte
MMRRC Submission 067772-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.222) question?
Stock # R8419 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 88635834-88653908 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 88651209 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Leucine at position 906 (S906L)
Ref Sequence ENSEMBL: ENSMUSP00000142854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031222] [ENSMUST00000199104]
AlphaFold O55196
Predicted Effect possibly damaging
Transcript: ENSMUST00000031222
AA Change: S831L

PolyPhen 2 Score 0.493 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000031222
Gene: ENSMUSG00000029286
AA Change: S831L

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
low complexity region 67 114 N/A INTRINSIC
low complexity region 128 150 N/A INTRINSIC
low complexity region 159 167 N/A INTRINSIC
low complexity region 173 187 N/A INTRINSIC
low complexity region 203 214 N/A INTRINSIC
Pfam:Enamelin 216 441 5.4e-74 PFAM
Pfam:Enamelin 503 1249 1.9e-303 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000199104
AA Change: S906L

PolyPhen 2 Score 0.804 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142854
Gene: ENSMUSG00000029286
AA Change: S906L

DomainStartEndE-ValueType
low complexity region 100 113 N/A INTRINSIC
low complexity region 142 189 N/A INTRINSIC
low complexity region 203 225 N/A INTRINSIC
low complexity region 234 242 N/A INTRINSIC
low complexity region 248 262 N/A INTRINSIC
low complexity region 278 289 N/A INTRINSIC
Pfam:Enamelin 291 510 2.5e-74 PFAM
Pfam:Enamelin 550 1325 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dental enamel forms the outer cap of teeth and is the hardest substance found in vertebrates. This gene encodes the largest protein in the enamel matrix of developing teeth. The protein is involved in the mineralization and structural organization of enamel. Defects in this gene result in amelogenesis imperfect type 1C.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous null mice lack true enamel due to loss of mineralization at the secretory surface of ameloblasts and mandibular incisors are opaque with a rough surface and abnormal wear on the incisal edge. ENU-induced mutant mice provide models for various clinical subtypes of amelogenesis imperfecta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 A T 11: 48,910,312 (GRCm39) I707N probably damaging Het
Abca14 A G 7: 119,815,489 (GRCm39) I246V probably benign Het
Adam19 G A 11: 46,015,850 (GRCm39) A337T possibly damaging Het
Ankrd40 G T 11: 94,225,662 (GRCm39) G231V probably damaging Het
Arhgap5 G A 12: 52,565,572 (GRCm39) V848I probably damaging Het
Bmpr2 G A 1: 59,906,515 (GRCm39) R536H probably damaging Het
Casz1 T A 4: 149,033,040 (GRCm39) S1310T probably benign Het
Chi3l1 A T 1: 134,117,280 (GRCm39) D367V probably damaging Het
Cltc A G 11: 86,598,392 (GRCm39) V990A probably benign Het
Col6a3 A T 1: 90,729,935 (GRCm39) S1790R probably damaging Het
Comt C T 16: 18,230,637 (GRCm39) W24* probably null Het
Cyp2c70 T C 19: 40,149,024 (GRCm39) E374G possibly damaging Het
Dach1 T C 14: 98,406,076 (GRCm39) T224A probably damaging Het
Dapk1 G A 13: 60,887,911 (GRCm39) E656K probably benign Het
Dicer1 A G 12: 104,668,936 (GRCm39) S1249P probably benign Het
Dpp8 A C 9: 64,988,037 (GRCm39) I861L probably benign Het
Eral1 A T 11: 77,964,906 (GRCm39) I429N possibly damaging Het
Fbxo10 C A 4: 45,041,809 (GRCm39) G807C possibly damaging Het
Fcgbpl1 G T 7: 27,843,346 (GRCm39) G745C probably damaging Het
Fsip2 G C 2: 82,808,963 (GRCm39) E1761Q probably damaging Het
Ggnbp2 C T 11: 84,728,815 (GRCm39) probably null Het
Gm4353 G A 7: 115,682,784 (GRCm39) P266S probably benign Het
Gpr84 T C 15: 103,217,963 (GRCm39) N38S probably damaging Het
Guca1a A T 17: 47,706,480 (GRCm39) I115N probably damaging Het
Hic1 C T 11: 75,057,096 (GRCm39) V598M possibly damaging Het
Itga1 A T 13: 115,143,604 (GRCm39) I309N probably damaging Het
Itga11 T C 9: 62,662,460 (GRCm39) S478P possibly damaging Het
Kctd8 T C 5: 69,497,713 (GRCm39) D311G probably damaging Het
Klhl32 T C 4: 24,682,203 (GRCm39) E127G possibly damaging Het
Lama2 T A 10: 27,298,559 (GRCm39) Y179F probably benign Het
Lamb2 G T 9: 108,365,563 (GRCm39) R1382L probably benign Het
Mrpl1 C G 5: 96,374,226 (GRCm39) A167G probably benign Het
Muc17 A T 5: 137,175,570 (GRCm39) N33K Het
Myt1 A T 2: 181,424,399 (GRCm39) R31* probably null Het
Nectin2 T C 7: 19,451,646 (GRCm39) T463A probably benign Het
Nectin2 A T 7: 19,472,003 (GRCm39) Y129N probably damaging Het
Or12d13 A G 17: 37,647,466 (GRCm39) I219T possibly damaging Het
Or4k47 A T 2: 111,451,849 (GRCm39) M190K probably benign Het
Papolb T A 5: 142,514,296 (GRCm39) N449I possibly damaging Het
Parn T C 16: 13,466,338 (GRCm39) K236R probably benign Het
Pramel22 A G 4: 143,382,997 (GRCm39) I74T probably damaging Het
Prelid1 G A 13: 55,470,698 (GRCm39) R42Q probably damaging Het
Prelp A G 1: 133,843,020 (GRCm39) F42L probably benign Het
Pygo1 C T 9: 72,852,380 (GRCm39) P189L probably damaging Het
Rimbp3 T A 16: 17,030,886 (GRCm39) S1437T probably damaging Het
Slc37a2 T A 9: 37,148,726 (GRCm39) D252V probably benign Het
Socs7 A G 11: 97,254,165 (GRCm39) K233R probably benign Het
Spopfm2 T C 3: 94,082,921 (GRCm39) I297V probably benign Het
Stat4 A G 1: 52,137,637 (GRCm39) D476G possibly damaging Het
Tesmin A G 19: 3,439,077 (GRCm39) D43G probably benign Het
Thap1 C A 8: 26,648,502 (GRCm39) Y8* probably null Het
Tln1 A G 4: 43,536,397 (GRCm39) L1965P probably damaging Het
Tmprss11d A G 5: 86,457,165 (GRCm39) S303P probably damaging Het
Tomm40 C T 7: 19,435,759 (GRCm39) V324M probably damaging Het
Vmn1r202 A T 13: 22,685,985 (GRCm39) I144K probably damaging Het
Other mutations in Enam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Enam APN 5 88,649,343 (GRCm39) missense possibly damaging 0.83
IGL01611:Enam APN 5 88,651,608 (GRCm39) missense probably damaging 0.99
IGL01802:Enam APN 5 88,651,533 (GRCm39) missense possibly damaging 0.93
IGL02220:Enam APN 5 88,652,418 (GRCm39) nonsense probably null
IGL02371:Enam APN 5 88,650,668 (GRCm39) missense probably benign 0.39
IGL02596:Enam APN 5 88,650,885 (GRCm39) missense probably benign 0.01
IGL03026:Enam APN 5 88,651,158 (GRCm39) missense probably benign 0.38
IGL03303:Enam APN 5 88,652,450 (GRCm39) missense probably benign 0.12
opinionated UTSW 5 88,650,885 (GRCm39) missense probably benign 0.04
recalcitrant UTSW 5 88,651,650 (GRCm39) nonsense probably null
R0200:Enam UTSW 5 88,640,886 (GRCm39) missense possibly damaging 0.96
R0230:Enam UTSW 5 88,637,514 (GRCm39) splice site probably benign
R0395:Enam UTSW 5 88,649,367 (GRCm39) missense probably damaging 0.99
R0548:Enam UTSW 5 88,650,964 (GRCm39) missense probably damaging 0.96
R0608:Enam UTSW 5 88,640,886 (GRCm39) missense possibly damaging 0.96
R0724:Enam UTSW 5 88,649,853 (GRCm39) missense probably damaging 1.00
R0927:Enam UTSW 5 88,641,919 (GRCm39) missense possibly damaging 0.72
R1023:Enam UTSW 5 88,649,826 (GRCm39) missense probably damaging 0.99
R1053:Enam UTSW 5 88,651,878 (GRCm39) missense possibly damaging 0.64
R1169:Enam UTSW 5 88,651,117 (GRCm39) missense probably damaging 1.00
R1230:Enam UTSW 5 88,641,927 (GRCm39) missense probably damaging 0.99
R1324:Enam UTSW 5 88,641,927 (GRCm39) missense possibly damaging 0.53
R1663:Enam UTSW 5 88,651,853 (GRCm39) missense probably damaging 1.00
R1727:Enam UTSW 5 88,651,853 (GRCm39) missense probably damaging 1.00
R1750:Enam UTSW 5 88,651,086 (GRCm39) missense probably damaging 1.00
R1852:Enam UTSW 5 88,652,324 (GRCm39) missense possibly damaging 0.92
R1907:Enam UTSW 5 88,652,481 (GRCm39) missense possibly damaging 0.86
R2104:Enam UTSW 5 88,649,646 (GRCm39) missense probably damaging 1.00
R2143:Enam UTSW 5 88,640,779 (GRCm39) missense probably benign 0.02
R2196:Enam UTSW 5 88,650,603 (GRCm39) missense probably damaging 0.99
R2363:Enam UTSW 5 88,651,008 (GRCm39) missense probably benign 0.24
R2497:Enam UTSW 5 88,650,553 (GRCm39) missense probably benign 0.13
R3615:Enam UTSW 5 88,652,306 (GRCm39) missense possibly damaging 0.81
R3616:Enam UTSW 5 88,652,306 (GRCm39) missense possibly damaging 0.81
R3782:Enam UTSW 5 88,650,674 (GRCm39) missense probably damaging 1.00
R4067:Enam UTSW 5 88,651,236 (GRCm39) missense probably damaging 1.00
R4349:Enam UTSW 5 88,651,407 (GRCm39) missense probably damaging 0.99
R4604:Enam UTSW 5 88,652,142 (GRCm39) missense possibly damaging 0.93
R4649:Enam UTSW 5 88,640,827 (GRCm39) missense probably benign 0.02
R4702:Enam UTSW 5 88,651,650 (GRCm39) nonsense probably null
R4703:Enam UTSW 5 88,651,650 (GRCm39) nonsense probably null
R4704:Enam UTSW 5 88,651,650 (GRCm39) nonsense probably null
R4705:Enam UTSW 5 88,651,650 (GRCm39) nonsense probably null
R4714:Enam UTSW 5 88,651,395 (GRCm39) missense probably damaging 1.00
R4748:Enam UTSW 5 88,649,402 (GRCm39) missense probably damaging 1.00
R4838:Enam UTSW 5 88,640,967 (GRCm39) nonsense probably null
R4840:Enam UTSW 5 88,650,885 (GRCm39) missense probably benign 0.04
R4856:Enam UTSW 5 88,636,593 (GRCm39) nonsense probably null
R4886:Enam UTSW 5 88,636,593 (GRCm39) nonsense probably null
R4910:Enam UTSW 5 88,650,173 (GRCm39) missense probably benign
R4911:Enam UTSW 5 88,650,173 (GRCm39) missense probably benign
R6103:Enam UTSW 5 88,650,187 (GRCm39) missense probably damaging 0.96
R6651:Enam UTSW 5 88,650,776 (GRCm39) missense probably damaging 0.98
R6759:Enam UTSW 5 88,649,550 (GRCm39) missense probably damaging 1.00
R7282:Enam UTSW 5 88,650,186 (GRCm39) missense probably damaging 0.99
R7365:Enam UTSW 5 88,649,347 (GRCm39) missense possibly damaging 0.75
R7392:Enam UTSW 5 88,649,523 (GRCm39) missense probably damaging 0.99
R7483:Enam UTSW 5 88,649,679 (GRCm39) missense probably damaging 1.00
R7647:Enam UTSW 5 88,650,884 (GRCm39) missense probably benign 0.00
R7648:Enam UTSW 5 88,652,016 (GRCm39) missense possibly damaging 0.89
R7672:Enam UTSW 5 88,651,830 (GRCm39) missense possibly damaging 0.80
R7943:Enam UTSW 5 88,636,410 (GRCm39) splice site probably null
R7999:Enam UTSW 5 88,651,561 (GRCm39) missense probably benign
R8117:Enam UTSW 5 88,651,385 (GRCm39) missense probably benign 0.00
R8528:Enam UTSW 5 88,650,078 (GRCm39) missense probably damaging 0.98
R8836:Enam UTSW 5 88,639,124 (GRCm39) critical splice donor site probably null
R8973:Enam UTSW 5 88,641,947 (GRCm39) missense possibly damaging 0.96
R9001:Enam UTSW 5 88,637,388 (GRCm39) missense probably benign 0.11
R9033:Enam UTSW 5 88,646,475 (GRCm39) missense probably benign 0.01
R9268:Enam UTSW 5 88,640,778 (GRCm39) missense probably benign 0.01
R9723:Enam UTSW 5 88,652,241 (GRCm39) missense probably damaging 1.00
X0018:Enam UTSW 5 88,650,550 (GRCm39) nonsense probably null
Z1176:Enam UTSW 5 88,640,830 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCCAGTACTATGATGCGGC -3'
(R):5'- AGAGAGTGCTTTCTTCTTGTCC -3'

Sequencing Primer
(F):5'- GTACTATGATGCGGCCAGAAAACC -3'
(R):5'- AGAGTGCTTTCTTCTTGTCCTATGGC -3'
Posted On 2020-10-20