Incidental Mutation 'R8419:Abca14'
ID 653092
Institutional Source Beutler Lab
Gene Symbol Abca14
Ensembl Gene ENSMUSG00000062017
Gene Name ATP-binding cassette, sub-family A member 14
Synonyms 1700110B15Rik, 4930539G24Rik
MMRRC Submission 067772-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8419 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 119803184-119924575 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 119815489 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 246 (I246V)
Ref Sequence ENSEMBL: ENSMUSP00000081690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084640]
AlphaFold E9Q8F8
Predicted Effect probably benign
Transcript: ENSMUST00000084640
AA Change: I246V

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000081690
Gene: ENSMUSG00000062017
AA Change: I246V

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 24 463 5.7e-23 PFAM
AAA 548 729 1.59e-10 SMART
Pfam:ABC2_membrane_3 902 1296 1.2e-36 PFAM
AAA 1384 1568 1.33e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 A T 11: 48,910,312 (GRCm39) I707N probably damaging Het
Adam19 G A 11: 46,015,850 (GRCm39) A337T possibly damaging Het
Ankrd40 G T 11: 94,225,662 (GRCm39) G231V probably damaging Het
Arhgap5 G A 12: 52,565,572 (GRCm39) V848I probably damaging Het
Bmpr2 G A 1: 59,906,515 (GRCm39) R536H probably damaging Het
Casz1 T A 4: 149,033,040 (GRCm39) S1310T probably benign Het
Chi3l1 A T 1: 134,117,280 (GRCm39) D367V probably damaging Het
Cltc A G 11: 86,598,392 (GRCm39) V990A probably benign Het
Col6a3 A T 1: 90,729,935 (GRCm39) S1790R probably damaging Het
Comt C T 16: 18,230,637 (GRCm39) W24* probably null Het
Cyp2c70 T C 19: 40,149,024 (GRCm39) E374G possibly damaging Het
Dach1 T C 14: 98,406,076 (GRCm39) T224A probably damaging Het
Dapk1 G A 13: 60,887,911 (GRCm39) E656K probably benign Het
Dicer1 A G 12: 104,668,936 (GRCm39) S1249P probably benign Het
Dpp8 A C 9: 64,988,037 (GRCm39) I861L probably benign Het
Enam C T 5: 88,651,209 (GRCm39) S906L possibly damaging Het
Eral1 A T 11: 77,964,906 (GRCm39) I429N possibly damaging Het
Fbxo10 C A 4: 45,041,809 (GRCm39) G807C possibly damaging Het
Fcgbpl1 G T 7: 27,843,346 (GRCm39) G745C probably damaging Het
Fsip2 G C 2: 82,808,963 (GRCm39) E1761Q probably damaging Het
Ggnbp2 C T 11: 84,728,815 (GRCm39) probably null Het
Gm4353 G A 7: 115,682,784 (GRCm39) P266S probably benign Het
Gpr84 T C 15: 103,217,963 (GRCm39) N38S probably damaging Het
Guca1a A T 17: 47,706,480 (GRCm39) I115N probably damaging Het
Hic1 C T 11: 75,057,096 (GRCm39) V598M possibly damaging Het
Itga1 A T 13: 115,143,604 (GRCm39) I309N probably damaging Het
Itga11 T C 9: 62,662,460 (GRCm39) S478P possibly damaging Het
Kctd8 T C 5: 69,497,713 (GRCm39) D311G probably damaging Het
Klhl32 T C 4: 24,682,203 (GRCm39) E127G possibly damaging Het
Lama2 T A 10: 27,298,559 (GRCm39) Y179F probably benign Het
Lamb2 G T 9: 108,365,563 (GRCm39) R1382L probably benign Het
Mrpl1 C G 5: 96,374,226 (GRCm39) A167G probably benign Het
Muc17 A T 5: 137,175,570 (GRCm39) N33K Het
Myt1 A T 2: 181,424,399 (GRCm39) R31* probably null Het
Nectin2 T C 7: 19,451,646 (GRCm39) T463A probably benign Het
Nectin2 A T 7: 19,472,003 (GRCm39) Y129N probably damaging Het
Or12d13 A G 17: 37,647,466 (GRCm39) I219T possibly damaging Het
Or4k47 A T 2: 111,451,849 (GRCm39) M190K probably benign Het
Papolb T A 5: 142,514,296 (GRCm39) N449I possibly damaging Het
Parn T C 16: 13,466,338 (GRCm39) K236R probably benign Het
Pramel22 A G 4: 143,382,997 (GRCm39) I74T probably damaging Het
Prelid1 G A 13: 55,470,698 (GRCm39) R42Q probably damaging Het
Prelp A G 1: 133,843,020 (GRCm39) F42L probably benign Het
Pygo1 C T 9: 72,852,380 (GRCm39) P189L probably damaging Het
Rimbp3 T A 16: 17,030,886 (GRCm39) S1437T probably damaging Het
Slc37a2 T A 9: 37,148,726 (GRCm39) D252V probably benign Het
Socs7 A G 11: 97,254,165 (GRCm39) K233R probably benign Het
Spopfm2 T C 3: 94,082,921 (GRCm39) I297V probably benign Het
Stat4 A G 1: 52,137,637 (GRCm39) D476G possibly damaging Het
Tesmin A G 19: 3,439,077 (GRCm39) D43G probably benign Het
Thap1 C A 8: 26,648,502 (GRCm39) Y8* probably null Het
Tln1 A G 4: 43,536,397 (GRCm39) L1965P probably damaging Het
Tmprss11d A G 5: 86,457,165 (GRCm39) S303P probably damaging Het
Tomm40 C T 7: 19,435,759 (GRCm39) V324M probably damaging Het
Vmn1r202 A T 13: 22,685,985 (GRCm39) I144K probably damaging Het
Other mutations in Abca14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Abca14 APN 7 119,846,076 (GRCm39) missense probably damaging 1.00
IGL00800:Abca14 APN 7 119,854,613 (GRCm39) missense probably benign 0.01
IGL00845:Abca14 APN 7 119,823,174 (GRCm39) splice site probably benign
IGL00897:Abca14 APN 7 119,815,348 (GRCm39) splice site probably benign
IGL01524:Abca14 APN 7 119,852,644 (GRCm39) missense possibly damaging 0.57
IGL01747:Abca14 APN 7 119,877,310 (GRCm39) missense probably benign 0.00
IGL02214:Abca14 APN 7 119,893,398 (GRCm39) missense probably benign 0.09
IGL02215:Abca14 APN 7 119,852,612 (GRCm39) missense probably benign 0.00
IGL02253:Abca14 APN 7 119,807,182 (GRCm39) missense probably benign 0.29
IGL02302:Abca14 APN 7 119,917,968 (GRCm39) splice site probably benign
IGL03391:Abca14 APN 7 119,846,107 (GRCm39) missense probably damaging 1.00
F6893:Abca14 UTSW 7 119,924,261 (GRCm39) missense probably damaging 0.98
R0109:Abca14 UTSW 7 119,917,985 (GRCm39) nonsense probably null
R0109:Abca14 UTSW 7 119,917,985 (GRCm39) nonsense probably null
R0265:Abca14 UTSW 7 119,822,850 (GRCm39) missense probably benign 0.03
R0326:Abca14 UTSW 7 119,823,642 (GRCm39) missense probably damaging 1.00
R0380:Abca14 UTSW 7 119,877,703 (GRCm39) missense probably benign 0.03
R0418:Abca14 UTSW 7 119,806,657 (GRCm39) missense probably damaging 1.00
R0539:Abca14 UTSW 7 119,807,020 (GRCm39) missense probably damaging 1.00
R0574:Abca14 UTSW 7 119,823,720 (GRCm39) missense probably damaging 0.96
R0611:Abca14 UTSW 7 119,851,479 (GRCm39) missense possibly damaging 0.63
R0783:Abca14 UTSW 7 119,893,380 (GRCm39) missense probably damaging 1.00
R0785:Abca14 UTSW 7 119,893,380 (GRCm39) missense probably damaging 1.00
R0863:Abca14 UTSW 7 119,815,453 (GRCm39) missense probably benign 0.03
R1034:Abca14 UTSW 7 119,815,370 (GRCm39) missense probably damaging 1.00
R1056:Abca14 UTSW 7 119,924,295 (GRCm39) missense probably damaging 1.00
R1072:Abca14 UTSW 7 119,811,992 (GRCm39) missense probably benign
R1244:Abca14 UTSW 7 119,815,561 (GRCm39) missense probably benign 0.06
R1255:Abca14 UTSW 7 119,807,016 (GRCm39) missense probably damaging 0.97
R1271:Abca14 UTSW 7 119,924,340 (GRCm39) missense probably damaging 1.00
R1325:Abca14 UTSW 7 119,846,545 (GRCm39) missense probably benign 0.32
R1457:Abca14 UTSW 7 119,888,683 (GRCm39) missense probably benign 0.00
R1467:Abca14 UTSW 7 119,815,405 (GRCm39) missense possibly damaging 0.80
R1467:Abca14 UTSW 7 119,815,405 (GRCm39) missense possibly damaging 0.80
R1494:Abca14 UTSW 7 119,815,524 (GRCm39) missense probably benign 0.00
R1551:Abca14 UTSW 7 119,918,101 (GRCm39) missense probably benign 0.10
R1607:Abca14 UTSW 7 119,850,514 (GRCm39) missense probably damaging 1.00
R1739:Abca14 UTSW 7 119,877,529 (GRCm39) missense probably benign 0.04
R1856:Abca14 UTSW 7 119,877,404 (GRCm39) missense probably damaging 1.00
R1875:Abca14 UTSW 7 119,847,190 (GRCm39) missense possibly damaging 0.78
R1892:Abca14 UTSW 7 119,815,561 (GRCm39) missense probably benign 0.06
R1898:Abca14 UTSW 7 119,850,392 (GRCm39) missense probably damaging 1.00
R1958:Abca14 UTSW 7 119,924,382 (GRCm39) missense probably damaging 0.98
R2018:Abca14 UTSW 7 119,815,408 (GRCm39) missense probably benign 0.00
R2039:Abca14 UTSW 7 119,911,487 (GRCm39) missense probably damaging 0.98
R2060:Abca14 UTSW 7 119,826,741 (GRCm39) nonsense probably null
R2202:Abca14 UTSW 7 119,888,764 (GRCm39) missense probably benign 0.17
R2205:Abca14 UTSW 7 119,846,503 (GRCm39) missense probably damaging 0.98
R2360:Abca14 UTSW 7 119,850,431 (GRCm39) missense probably benign 0.00
R2401:Abca14 UTSW 7 119,882,312 (GRCm39) missense probably damaging 1.00
R2426:Abca14 UTSW 7 119,882,446 (GRCm39) missense probably benign 0.04
R3433:Abca14 UTSW 7 119,893,455 (GRCm39) missense probably damaging 0.97
R4598:Abca14 UTSW 7 119,854,626 (GRCm39) missense probably benign 0.11
R4599:Abca14 UTSW 7 119,854,626 (GRCm39) missense probably benign 0.11
R4700:Abca14 UTSW 7 119,911,928 (GRCm39) critical splice donor site probably null
R4751:Abca14 UTSW 7 119,911,400 (GRCm39) missense probably benign 0.01
R4826:Abca14 UTSW 7 119,815,470 (GRCm39) missense probably damaging 1.00
R4828:Abca14 UTSW 7 119,815,470 (GRCm39) missense probably damaging 1.00
R4837:Abca14 UTSW 7 119,846,203 (GRCm39) missense probably benign
R4881:Abca14 UTSW 7 119,877,472 (GRCm39) missense possibly damaging 0.49
R4895:Abca14 UTSW 7 119,846,572 (GRCm39) critical splice donor site probably null
R4928:Abca14 UTSW 7 119,923,803 (GRCm39) missense possibly damaging 0.90
R4990:Abca14 UTSW 7 119,911,388 (GRCm39) missense probably benign 0.00
R5027:Abca14 UTSW 7 119,911,505 (GRCm39) missense probably benign 0.05
R5091:Abca14 UTSW 7 119,851,497 (GRCm39) missense probably damaging 1.00
R5158:Abca14 UTSW 7 119,852,652 (GRCm39) missense probably benign
R5209:Abca14 UTSW 7 119,832,130 (GRCm39) missense probably benign 0.01
R5333:Abca14 UTSW 7 119,888,769 (GRCm39) nonsense probably null
R5424:Abca14 UTSW 7 119,810,777 (GRCm39) missense probably benign 0.01
R5488:Abca14 UTSW 7 119,851,473 (GRCm39) missense probably damaging 0.98
R5489:Abca14 UTSW 7 119,851,473 (GRCm39) missense probably damaging 0.98
R5716:Abca14 UTSW 7 119,846,217 (GRCm39) critical splice donor site probably null
R6450:Abca14 UTSW 7 119,815,449 (GRCm39) missense probably benign 0.17
R6477:Abca14 UTSW 7 119,924,325 (GRCm39) missense probably benign 0.44
R6652:Abca14 UTSW 7 119,846,164 (GRCm39) missense probably damaging 1.00
R6782:Abca14 UTSW 7 119,847,308 (GRCm39) missense probably damaging 1.00
R6874:Abca14 UTSW 7 119,851,428 (GRCm39) missense possibly damaging 0.71
R6965:Abca14 UTSW 7 119,882,452 (GRCm39) nonsense probably null
R7142:Abca14 UTSW 7 119,850,406 (GRCm39) missense possibly damaging 0.89
R7146:Abca14 UTSW 7 119,854,520 (GRCm39) missense probably benign 0.15
R7202:Abca14 UTSW 7 119,917,236 (GRCm39) missense probably damaging 1.00
R7220:Abca14 UTSW 7 119,826,667 (GRCm39) missense possibly damaging 0.45
R7241:Abca14 UTSW 7 119,846,184 (GRCm39) missense probably damaging 1.00
R7291:Abca14 UTSW 7 119,888,832 (GRCm39) nonsense probably null
R7296:Abca14 UTSW 7 119,877,534 (GRCm39) missense probably benign
R7298:Abca14 UTSW 7 119,807,106 (GRCm39) missense probably benign 0.00
R7315:Abca14 UTSW 7 119,893,341 (GRCm39) missense probably benign 0.00
R7776:Abca14 UTSW 7 119,832,214 (GRCm39) critical splice donor site probably null
R7820:Abca14 UTSW 7 119,811,944 (GRCm39) missense probably benign 0.42
R7873:Abca14 UTSW 7 119,888,792 (GRCm39) missense probably benign 0.17
R8215:Abca14 UTSW 7 119,893,425 (GRCm39) missense probably benign
R8332:Abca14 UTSW 7 119,815,436 (GRCm39) missense probably benign
R8444:Abca14 UTSW 7 119,918,133 (GRCm39) missense probably damaging 1.00
R8818:Abca14 UTSW 7 119,815,524 (GRCm39) missense probably benign 0.00
R8834:Abca14 UTSW 7 119,877,372 (GRCm39) missense probably benign 0.02
R8845:Abca14 UTSW 7 119,846,428 (GRCm39) missense probably benign 0.00
R8889:Abca14 UTSW 7 119,815,606 (GRCm39) missense probably damaging 1.00
R8892:Abca14 UTSW 7 119,815,606 (GRCm39) missense probably damaging 1.00
R8894:Abca14 UTSW 7 119,847,368 (GRCm39) missense probably damaging 1.00
R8903:Abca14 UTSW 7 119,815,526 (GRCm39) missense probably damaging 0.98
R8950:Abca14 UTSW 7 119,823,595 (GRCm39) missense possibly damaging 0.92
R8950:Abca14 UTSW 7 119,823,644 (GRCm39) nonsense probably null
R9018:Abca14 UTSW 7 119,918,532 (GRCm39) missense probably damaging 0.98
R9018:Abca14 UTSW 7 119,888,763 (GRCm39) missense probably benign 0.01
R9110:Abca14 UTSW 7 119,831,615 (GRCm39) intron probably benign
R9254:Abca14 UTSW 7 119,807,202 (GRCm39) nonsense probably null
R9376:Abca14 UTSW 7 119,893,438 (GRCm39) missense probably damaging 1.00
R9378:Abca14 UTSW 7 119,807,191 (GRCm39) missense possibly damaging 0.64
R9379:Abca14 UTSW 7 119,807,202 (GRCm39) nonsense probably null
R9388:Abca14 UTSW 7 119,882,261 (GRCm39) missense probably benign 0.01
R9445:Abca14 UTSW 7 119,877,691 (GRCm39) missense probably benign 0.05
R9522:Abca14 UTSW 7 119,847,368 (GRCm39) missense probably null 0.98
R9577:Abca14 UTSW 7 119,810,768 (GRCm39) missense probably benign 0.27
R9627:Abca14 UTSW 7 119,854,530 (GRCm39) missense probably benign 0.00
R9639:Abca14 UTSW 7 119,893,345 (GRCm39) missense probably benign 0.01
R9660:Abca14 UTSW 7 119,851,478 (GRCm39) missense probably benign 0.00
R9696:Abca14 UTSW 7 119,888,734 (GRCm39) missense possibly damaging 0.59
R9709:Abca14 UTSW 7 119,888,739 (GRCm39) nonsense probably null
R9780:Abca14 UTSW 7 119,911,447 (GRCm39) missense probably benign 0.00
Z1088:Abca14 UTSW 7 119,815,358 (GRCm39) missense probably benign 0.14
Z1176:Abca14 UTSW 7 119,846,146 (GRCm39) missense probably damaging 1.00
Z1177:Abca14 UTSW 7 119,917,210 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTATCCTGAACTTGACAGTCTCTG -3'
(R):5'- ACACTATTCTGCTGGCCCAG -3'

Sequencing Primer
(F):5'- CCTGAACTTGACAGTCTCTGGTTTTG -3'
(R):5'- TCTGCTGGCCCAGAATATTAC -3'
Posted On 2020-10-20