Incidental Mutation 'R8419:Itga11'
ID653095
Institutional Source Beutler Lab
Gene Symbol Itga11
Ensembl Gene ENSMUSG00000032243
Gene Nameintegrin alpha 11
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R8419 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location62677826-62783982 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62755178 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 478 (S478P)
Ref Sequence ENSEMBL: ENSMUSP00000034774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034774]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034774
AA Change: S478P

PolyPhen 2 Score 0.591 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000034774
Gene: ENSMUSG00000032243
AA Change: S478P

DomainStartEndE-ValueType
Int_alpha 37 90 3.9e-7 SMART
VWA 162 350 2.74e-38 SMART
Int_alpha 421 472 2.19e-1 SMART
Int_alpha 476 532 3.75e-9 SMART
Int_alpha 538 593 1.39e-12 SMART
Int_alpha 600 654 1.08e0 SMART
transmembrane domain 1142 1164 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha integrin. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein contains an I domain, is expressed in muscle tissue, dimerizes with beta 1 integrin in vitro, and appears to bind collagen in this form. Therefore, the protein may be involved in attaching muscle tissue to the extracellular matrix. Alternative transcriptional splice variants have been found for this gene, but their biological validity is not determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption of this gene display dwarfism, increased mortality with age, and defective incisors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik G T 7: 28,143,921 G745C probably damaging Het
9930111J21Rik2 A T 11: 49,019,485 I707N probably damaging Het
Abca14 A G 7: 120,216,266 I246V probably benign Het
Adam19 G A 11: 46,125,023 A337T possibly damaging Het
Ankrd40 G T 11: 94,334,836 G231V probably damaging Het
Arhgap5 G A 12: 52,518,789 V848I probably damaging Het
Bmpr2 G A 1: 59,867,356 R536H probably damaging Het
Casz1 T A 4: 148,948,583 S1310T probably benign Het
Chil1 A T 1: 134,189,542 D367V probably damaging Het
Cltc A G 11: 86,707,566 V990A probably benign Het
Col6a3 A T 1: 90,802,213 S1790R probably damaging Het
Comt C T 16: 18,411,887 W24* probably null Het
Cyp2c70 T C 19: 40,160,580 E374G possibly damaging Het
Dach1 T C 14: 98,168,640 T224A probably damaging Het
Dapk1 G A 13: 60,740,097 E656K probably benign Het
Dicer1 A G 12: 104,702,677 S1249P probably benign Het
Dpp8 A C 9: 65,080,755 I861L probably benign Het
Enam C T 5: 88,503,350 S906L possibly damaging Het
Eral1 A T 11: 78,074,080 I429N possibly damaging Het
Fbxo10 C A 4: 45,041,809 G807C possibly damaging Het
Fsip2 G C 2: 82,978,619 E1761Q probably damaging Het
Ggnbp2 C T 11: 84,837,989 probably null Het
Gm10696 T C 3: 94,175,614 I297V probably benign Het
Gm13088 A G 4: 143,656,427 I74T probably damaging Het
Gm4353 G A 7: 116,083,549 P266S probably benign Het
Gpr84 T C 15: 103,309,536 N38S probably damaging Het
Guca1a A T 17: 47,395,555 I115N probably damaging Het
Hic1 C T 11: 75,166,270 V598M possibly damaging Het
Itga1 A T 13: 115,007,068 I309N probably damaging Het
Kctd8 T C 5: 69,340,370 D311G probably damaging Het
Klhl32 T C 4: 24,682,203 E127G possibly damaging Het
Lama2 T A 10: 27,422,563 Y179F probably benign Het
Lamb2 G T 9: 108,488,364 R1382L probably benign Het
Mrpl1 C G 5: 96,226,367 A167G probably benign Het
Muc3 A T 5: 137,146,722 N33K Het
Myt1 A T 2: 181,782,606 R31* probably null Het
Nectin2 T C 7: 19,717,721 T463A probably benign Het
Nectin2 A T 7: 19,738,078 Y129N probably damaging Het
Olfr103 A G 17: 37,336,575 I219T possibly damaging Het
Olfr1297 A T 2: 111,621,504 M190K probably benign Het
Papolb T A 5: 142,528,541 N449I possibly damaging Het
Parn T C 16: 13,648,474 K236R probably benign Het
Prelid1 G A 13: 55,322,885 R42Q probably damaging Het
Prelp A G 1: 133,915,282 F42L probably benign Het
Pygo1 C T 9: 72,945,098 P189L probably damaging Het
Rimbp3 T A 16: 17,213,022 S1437T probably damaging Het
Slc37a2 T A 9: 37,237,430 D252V probably benign Het
Socs7 A G 11: 97,363,339 K233R probably benign Het
Stat4 A G 1: 52,098,478 D476G possibly damaging Het
Tesmin A G 19: 3,389,077 D43G probably benign Het
Thap1 C A 8: 26,158,474 Y8* probably null Het
Tln1 A G 4: 43,536,397 L1965P probably damaging Het
Tmprss11d A G 5: 86,309,306 S303P probably damaging Het
Tomm40 C T 7: 19,701,834 V324M probably damaging Het
Vmn1r202 A T 13: 22,501,815 I144K probably damaging Het
Other mutations in Itga11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Itga11 APN 9 62769305 missense possibly damaging 0.58
IGL01108:Itga11 APN 9 62757621 missense probably benign
IGL01348:Itga11 APN 9 62744579 missense possibly damaging 0.83
IGL01739:Itga11 APN 9 62774117 missense probably benign 0.03
IGL01918:Itga11 APN 9 62772996 missense probably benign 0.05
IGL02237:Itga11 APN 9 62755775 critical splice donor site probably null
IGL02418:Itga11 APN 9 62744632 missense probably benign 0.30
IGL02451:Itga11 APN 9 62735353 missense probably damaging 1.00
sneezy UTSW 9 62732109 missense probably damaging 1.00
PIT4812001:Itga11 UTSW 9 62732193 missense probably damaging 1.00
R0013:Itga11 UTSW 9 62776613 missense possibly damaging 0.89
R0013:Itga11 UTSW 9 62776613 missense possibly damaging 0.89
R0032:Itga11 UTSW 9 62774095 missense probably benign 0.05
R0032:Itga11 UTSW 9 62774095 missense probably benign 0.05
R0101:Itga11 UTSW 9 62744486 missense probably damaging 1.00
R0114:Itga11 UTSW 9 62735293 missense probably damaging 1.00
R0114:Itga11 UTSW 9 62760302 missense possibly damaging 0.85
R0212:Itga11 UTSW 9 62745969 missense probably benign 0.22
R0310:Itga11 UTSW 9 62760346 missense probably damaging 1.00
R0455:Itga11 UTSW 9 62696961 missense probably damaging 1.00
R0558:Itga11 UTSW 9 62752288 missense probably benign 0.01
R0607:Itga11 UTSW 9 62774371 missense probably benign 0.00
R0924:Itga11 UTSW 9 62776674 missense probably benign 0.14
R1085:Itga11 UTSW 9 62677970 missense probably benign 0.03
R1477:Itga11 UTSW 9 62755211 missense probably benign
R1647:Itga11 UTSW 9 62760370 missense probably benign 0.01
R1831:Itga11 UTSW 9 62782018 missense probably damaging 1.00
R1880:Itga11 UTSW 9 62677949 missense probably benign 0.06
R1934:Itga11 UTSW 9 62744514 missense probably damaging 1.00
R2025:Itga11 UTSW 9 62762811 missense probably damaging 1.00
R2046:Itga11 UTSW 9 62727697 missense probably damaging 1.00
R2145:Itga11 UTSW 9 62732204 splice site probably benign
R2922:Itga11 UTSW 9 62768630 splice site probably benign
R3011:Itga11 UTSW 9 62696980 missense probably damaging 0.99
R3158:Itga11 UTSW 9 62769278 missense probably benign 0.02
R3809:Itga11 UTSW 9 62771382 missense probably benign
R3836:Itga11 UTSW 9 62769283 missense probably benign 0.00
R4051:Itga11 UTSW 9 62755651 nonsense probably null
R4190:Itga11 UTSW 9 62732109 missense probably damaging 1.00
R4510:Itga11 UTSW 9 62761588 missense probably damaging 0.96
R4511:Itga11 UTSW 9 62761588 missense probably damaging 0.96
R4678:Itga11 UTSW 9 62735357 missense probably damaging 0.98
R4706:Itga11 UTSW 9 62755296 missense possibly damaging 0.64
R4713:Itga11 UTSW 9 62765788 missense probably damaging 1.00
R4798:Itga11 UTSW 9 62776727 splice site probably null
R4909:Itga11 UTSW 9 62755299 missense probably damaging 1.00
R4915:Itga11 UTSW 9 62752248 nonsense probably null
R4957:Itga11 UTSW 9 62767648 missense probably benign 0.00
R4962:Itga11 UTSW 9 62761568 nonsense probably null
R5081:Itga11 UTSW 9 62755196 missense probably benign 0.13
R5265:Itga11 UTSW 9 62737412 missense probably benign 0.05
R5308:Itga11 UTSW 9 62755769 missense probably benign
R5398:Itga11 UTSW 9 62745923 missense probably benign 0.21
R5717:Itga11 UTSW 9 62752249 missense probably benign 0.26
R5885:Itga11 UTSW 9 62762850 missense probably damaging 0.99
R5996:Itga11 UTSW 9 62755673 missense probably benign 0.01
R6394:Itga11 UTSW 9 62735266 splice site probably null
R6751:Itga11 UTSW 9 62768584 missense probably benign 0.02
R7041:Itga11 UTSW 9 62752256 missense probably damaging 1.00
R7264:Itga11 UTSW 9 62745908 missense probably benign 0.02
R7509:Itga11 UTSW 9 62781940 missense probably benign
R7601:Itga11 UTSW 9 62696926 missense probably benign 0.18
R7615:Itga11 UTSW 9 62744018 missense probably benign 0.00
R8263:Itga11 UTSW 9 62696980 missense possibly damaging 0.86
R8285:Itga11 UTSW 9 62752258 missense probably damaging 1.00
R8422:Itga11 UTSW 9 62767678 missense probably benign 0.00
R8469:Itga11 UTSW 9 62771398 missense probably benign 0.00
R8475:Itga11 UTSW 9 62744045 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGTTAACCCACCTGCTG -3'
(R):5'- TTAACCAAGTCAGAGCAGGGC -3'

Sequencing Primer
(F):5'- TTAACCCACCTGCTGGCTGG -3'
(R):5'- CTCTGATGCCCCGAAGAGCTG -3'
Posted On2020-10-20