Incidental Mutation 'R8419:Adam19'
ID 653100
Institutional Source Beutler Lab
Gene Symbol Adam19
Ensembl Gene ENSMUSG00000011256
Gene Name a disintegrin and metallopeptidase domain 19 (meltrin beta)
Synonyms Mltnb
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8419 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 46055992-46147343 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 46125023 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 337 (A337T)
Ref Sequence ENSEMBL: ENSMUSP00000011400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011400]
AlphaFold O35674
Predicted Effect possibly damaging
Transcript: ENSMUST00000011400
AA Change: A337T

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000011400
Gene: ENSMUSG00000011256
AA Change: A337T

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Pep_M12B_propep 32 163 9.4e-27 PFAM
Pfam:Reprolysin_5 209 388 1.9e-25 PFAM
Pfam:Reprolysin_4 209 399 1.5e-15 PFAM
Pfam:Reprolysin 211 409 1.3e-68 PFAM
Pfam:Reprolysin_2 231 399 6.1e-19 PFAM
Pfam:Reprolysin_3 235 357 1.2e-19 PFAM
DISIN 426 501 9.7e-41 SMART
ACR 502 650 7.46e-62 SMART
transmembrane domain 704 726 N/A INTRINSIC
low complexity region 788 797 N/A INTRINSIC
low complexity region 832 846 N/A INTRINSIC
low complexity region 886 905 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a cell surface glycoprotein and member of the ADAM (a disintegrin and metalloproteinase) family of endopeptidases. The encoded protein may play a role in the ectodomain shedding of neuregulin proteins. Homozygous knockout mice for this gene exhibit heart development defects and perinatal lethality. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that undergoes proteolytic processing to generate a mature protein product. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mice exhibit cardiac developmental defects and die perinatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik G T 7: 28,143,921 G745C probably damaging Het
9930111J21Rik2 A T 11: 49,019,485 I707N probably damaging Het
Abca14 A G 7: 120,216,266 I246V probably benign Het
Ankrd40 G T 11: 94,334,836 G231V probably damaging Het
Arhgap5 G A 12: 52,518,789 V848I probably damaging Het
Bmpr2 G A 1: 59,867,356 R536H probably damaging Het
Casz1 T A 4: 148,948,583 S1310T probably benign Het
Chil1 A T 1: 134,189,542 D367V probably damaging Het
Cltc A G 11: 86,707,566 V990A probably benign Het
Col6a3 A T 1: 90,802,213 S1790R probably damaging Het
Comt C T 16: 18,411,887 W24* probably null Het
Cyp2c70 T C 19: 40,160,580 E374G possibly damaging Het
Dach1 T C 14: 98,168,640 T224A probably damaging Het
Dapk1 G A 13: 60,740,097 E656K probably benign Het
Dicer1 A G 12: 104,702,677 S1249P probably benign Het
Dpp8 A C 9: 65,080,755 I861L probably benign Het
Enam C T 5: 88,503,350 S906L possibly damaging Het
Eral1 A T 11: 78,074,080 I429N possibly damaging Het
Fbxo10 C A 4: 45,041,809 G807C possibly damaging Het
Fsip2 G C 2: 82,978,619 E1761Q probably damaging Het
Ggnbp2 C T 11: 84,837,989 probably null Het
Gm10696 T C 3: 94,175,614 I297V probably benign Het
Gm13088 A G 4: 143,656,427 I74T probably damaging Het
Gm4353 G A 7: 116,083,549 P266S probably benign Het
Gpr84 T C 15: 103,309,536 N38S probably damaging Het
Guca1a A T 17: 47,395,555 I115N probably damaging Het
Hic1 C T 11: 75,166,270 V598M possibly damaging Het
Itga1 A T 13: 115,007,068 I309N probably damaging Het
Itga11 T C 9: 62,755,178 S478P possibly damaging Het
Kctd8 T C 5: 69,340,370 D311G probably damaging Het
Klhl32 T C 4: 24,682,203 E127G possibly damaging Het
Lama2 T A 10: 27,422,563 Y179F probably benign Het
Lamb2 G T 9: 108,488,364 R1382L probably benign Het
Mrpl1 C G 5: 96,226,367 A167G probably benign Het
Muc3 A T 5: 137,146,722 N33K Het
Myt1 A T 2: 181,782,606 R31* probably null Het
Nectin2 T C 7: 19,717,721 T463A probably benign Het
Nectin2 A T 7: 19,738,078 Y129N probably damaging Het
Olfr103 A G 17: 37,336,575 I219T possibly damaging Het
Olfr1297 A T 2: 111,621,504 M190K probably benign Het
Papolb T A 5: 142,528,541 N449I possibly damaging Het
Parn T C 16: 13,648,474 K236R probably benign Het
Prelid1 G A 13: 55,322,885 R42Q probably damaging Het
Prelp A G 1: 133,915,282 F42L probably benign Het
Pygo1 C T 9: 72,945,098 P189L probably damaging Het
Rimbp3 T A 16: 17,213,022 S1437T probably damaging Het
Slc37a2 T A 9: 37,237,430 D252V probably benign Het
Socs7 A G 11: 97,363,339 K233R probably benign Het
Stat4 A G 1: 52,098,478 D476G possibly damaging Het
Tesmin A G 19: 3,389,077 D43G probably benign Het
Thap1 C A 8: 26,158,474 Y8* probably null Het
Tln1 A G 4: 43,536,397 L1965P probably damaging Het
Tmprss11d A G 5: 86,309,306 S303P probably damaging Het
Tomm40 C T 7: 19,701,834 V324M probably damaging Het
Vmn1r202 A T 13: 22,501,815 I144K probably damaging Het
Other mutations in Adam19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:Adam19 APN 11 46112783 missense probably damaging 1.00
IGL01727:Adam19 APN 11 46121553 missense probably benign
IGL01758:Adam19 APN 11 46112924 missense probably benign 0.01
IGL02160:Adam19 APN 11 46139695 missense probably damaging 0.99
IGL02421:Adam19 APN 11 46137553 missense probably damaging 0.96
IGL02572:Adam19 APN 11 46131721 nonsense probably null
IGL02995:Adam19 APN 11 46136349 missense probably benign 0.00
IGL03171:Adam19 APN 11 46138854 missense probably damaging 0.98
IGL03237:Adam19 APN 11 46137556 missense probably benign
R0003:Adam19 UTSW 11 46128789 missense probably damaging 1.00
R0026:Adam19 UTSW 11 46136259 missense probably damaging 1.00
R0158:Adam19 UTSW 11 46143034 missense probably damaging 1.00
R0304:Adam19 UTSW 11 46127392 missense possibly damaging 0.91
R0488:Adam19 UTSW 11 46138930 missense probably damaging 0.98
R0501:Adam19 UTSW 11 46123130 missense probably damaging 1.00
R0591:Adam19 UTSW 11 46121411 splice site probably benign
R0734:Adam19 UTSW 11 46127403 missense probably damaging 0.99
R0747:Adam19 UTSW 11 46118495 splice site probably null
R0771:Adam19 UTSW 11 46121453 missense possibly damaging 0.92
R1052:Adam19 UTSW 11 46127265 missense probably damaging 0.99
R1573:Adam19 UTSW 11 46113618 splice site probably benign
R1735:Adam19 UTSW 11 46138917 missense probably benign 0.26
R1830:Adam19 UTSW 11 46127278 missense probably damaging 0.98
R1911:Adam19 UTSW 11 46121454 missense probably damaging 1.00
R2092:Adam19 UTSW 11 46060904 splice site probably null
R3749:Adam19 UTSW 11 46137610 missense probably benign 0.00
R3893:Adam19 UTSW 11 46128838 missense probably damaging 1.00
R3916:Adam19 UTSW 11 46060935 missense probably benign 0.25
R3917:Adam19 UTSW 11 46060935 missense probably benign 0.25
R4506:Adam19 UTSW 11 46118444 missense possibly damaging 0.67
R4767:Adam19 UTSW 11 46138977 critical splice donor site probably null
R5055:Adam19 UTSW 11 46123169 missense probably damaging 1.00
R5313:Adam19 UTSW 11 46131776 missense probably damaging 1.00
R5329:Adam19 UTSW 11 46125026 missense probably damaging 0.99
R5567:Adam19 UTSW 11 46136250 missense probably damaging 1.00
R5602:Adam19 UTSW 11 46136315 missense probably benign
R6198:Adam19 UTSW 11 46121502 missense probably damaging 1.00
R6875:Adam19 UTSW 11 46112875 missense probably benign
R7011:Adam19 UTSW 11 46143018 missense probably benign 0.00
R7163:Adam19 UTSW 11 46131717 missense probably benign
R7213:Adam19 UTSW 11 46121471 missense probably benign 0.20
R7267:Adam19 UTSW 11 46121576 nonsense probably null
R7896:Adam19 UTSW 11 46137543 missense probably damaging 1.00
R8012:Adam19 UTSW 11 46065046 missense possibly damaging 0.74
R8059:Adam19 UTSW 11 46136466 splice site probably benign
R8243:Adam19 UTSW 11 46125082 missense probably damaging 1.00
R8357:Adam19 UTSW 11 46140112 missense probably damaging 0.96
R8457:Adam19 UTSW 11 46140112 missense probably damaging 0.96
R9163:Adam19 UTSW 11 46127349 missense probably benign 0.02
R9349:Adam19 UTSW 11 46131743 nonsense probably null
R9489:Adam19 UTSW 11 46137622 missense probably benign 0.10
R9579:Adam19 UTSW 11 46118435 missense not run
X0067:Adam19 UTSW 11 46056115 start codon destroyed probably null 0.06
Predicted Primers PCR Primer
(F):5'- ATCAATGGAGCGCTGTCAG -3'
(R):5'- ATCTAGGCCATCTGACCCTG -3'

Sequencing Primer
(F):5'- TTTAATCCCAGCACTCAGGAGG -3'
(R):5'- ATCTGACCCTGCACCTCTCAG -3'
Posted On 2020-10-20