Mutagenetix > Incidental Mutation

Incidental Mutation 'R8419:Hic1'

653102

Institutional Source

Beutler Lab

Gene Symbol

Hic1

Ensembl Gene

ENSMUSG00000043099

Gene Name

hypermethylated in cancer 1

Synonyms

HIC-1

MMRRC Submission

067772-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.286) question?

Stock #

R8419 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

75164565-75169519 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 75166270 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 598 (V598M)

Ref Sequence

ENSEMBL: ENSMUSP00000053483 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045281] [ENSMUST00000055619]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000045281

SMART Domains

Protein: ENSMUSP00000043555
Gene: ENSMUSG00000038290

Domain	Start	End	E-Value	Type
internal_repeat_1	42	99	7.68e-6	PROSPERO
internal_repeat_1	135	188	7.68e-6	PROSPERO
low complexity region	212	227	N/A	INTRINSIC
low complexity region	257	271	N/A	INTRINSIC
low complexity region	376	390	N/A	INTRINSIC
low complexity region	417	426	N/A	INTRINSIC
low complexity region	436	453	N/A	INTRINSIC
low complexity region	538	549	N/A	INTRINSIC
coiled coil region	574	600	N/A	INTRINSIC
Pfam:EST1	637	742	1.8e-18	PFAM
Pfam:EST1_DNA_bind	750	1106	1.6e-78	PFAM
coiled coil region	1197	1234	N/A	INTRINSIC
PINc	1245	1396	2.85e-25	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000055619
AA Change: V598M

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000053483
Gene: ENSMUSG00000043099
AA Change: V598M

Domain	Start	End	E-Value	Type
low complexity region	71	81	N/A	INTRINSIC
low complexity region	192	200	N/A	INTRINSIC
BTB	207	313	6.94e-24	SMART
low complexity region	318	340	N/A	INTRINSIC
low complexity region	350	370	N/A	INTRINSIC
Blast:BTB	375	398	1e-7	BLAST
low complexity region	415	437	N/A	INTRINSIC
low complexity region	442	453	N/A	INTRINSIC
low complexity region	464	486	N/A	INTRINSIC
low complexity region	519	542	N/A	INTRINSIC
ZnF_C2H2	597	619	1.08e-1	SMART
ZnF_C2H2	667	689	1.18e-2	SMART
ZnF_C2H2	695	717	9.36e-6	SMART
ZnF_C2H2	723	745	4.54e-4	SMART
ZnF_C2H2	751	773	5.21e-4	SMART
low complexity region	774	804	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000130145

SMART Domains

Protein: ENSMUSP00000120229
Gene: ENSMUSG00000038290

Domain	Start	End	E-Value	Type
coiled coil region	35	61	N/A	INTRINSIC
Pfam:EST1	99	204	1.3e-19	PFAM
Pfam:EST1_DNA_bind	212	339	7.3e-37	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene functions as a growth regulatory and tumor repressor gene. Hypermethylation or deletion of the region of this gene have been associated with tumors and the contiguous-gene syndrome, Miller-Dieker syndrome. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit varying abnormalities, such as acrania, exencephaly, cleft palate, limb defects, and omphalocele, and die perinatally. Heterozygotes develop tumors, including lymphomas, sarcomas, and epithelial cancers. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530053A07Rik	G	T	7: 28,143,921	G745C	probably damaging	Het
9930111J21Rik2	A	T	11: 49,019,485	I707N	probably damaging	Het
Abca14	A	G	7: 120,216,266	I246V	probably benign	Het
Adam19	G	A	11: 46,125,023	A337T	possibly damaging	Het
Ankrd40	G	T	11: 94,334,836	G231V	probably damaging	Het
Arhgap5	G	A	12: 52,518,789	V848I	probably damaging	Het
Bmpr2	G	A	1: 59,867,356	R536H	probably damaging	Het
Casz1	T	A	4: 148,948,583	S1310T	probably benign	Het
Chil1	A	T	1: 134,189,542	D367V	probably damaging	Het
Cltc	A	G	11: 86,707,566	V990A	probably benign	Het
Col6a3	A	T	1: 90,802,213	S1790R	probably damaging	Het
Comt	C	T	16: 18,411,887	W24*	probably null	Het
Cyp2c70	T	C	19: 40,160,580	E374G	possibly damaging	Het
Dach1	T	C	14: 98,168,640	T224A	probably damaging	Het
Dapk1	G	A	13: 60,740,097	E656K	probably benign	Het
Dicer1	A	G	12: 104,702,677	S1249P	probably benign	Het
Dpp8	A	C	9: 65,080,755	I861L	probably benign	Het
Enam	C	T	5: 88,503,350	S906L	possibly damaging	Het
Eral1	A	T	11: 78,074,080	I429N	possibly damaging	Het
Fbxo10	C	A	4: 45,041,809	G807C	possibly damaging	Het
Fsip2	G	C	2: 82,978,619	E1761Q	probably damaging	Het
Ggnbp2	C	T	11: 84,837,989		probably null	Het
Gm10696	T	C	3: 94,175,614	I297V	probably benign	Het
Gm13088	A	G	4: 143,656,427	I74T	probably damaging	Het
Gm4353	G	A	7: 116,083,549	P266S	probably benign	Het
Gpr84	T	C	15: 103,309,536	N38S	probably damaging	Het
Guca1a	A	T	17: 47,395,555	I115N	probably damaging	Het
Itga1	A	T	13: 115,007,068	I309N	probably damaging	Het
Itga11	T	C	9: 62,755,178	S478P	possibly damaging	Het
Kctd8	T	C	5: 69,340,370	D311G	probably damaging	Het
Klhl32	T	C	4: 24,682,203	E127G	possibly damaging	Het
Lama2	T	A	10: 27,422,563	Y179F	probably benign	Het
Lamb2	G	T	9: 108,488,364	R1382L	probably benign	Het
Mrpl1	C	G	5: 96,226,367	A167G	probably benign	Het
Muc3	A	T	5: 137,146,722	N33K		Het
Myt1	A	T	2: 181,782,606	R31*	probably null	Het
Nectin2	T	C	7: 19,717,721	T463A	probably benign	Het
Nectin2	A	T	7: 19,738,078	Y129N	probably damaging	Het
Olfr103	A	G	17: 37,336,575	I219T	possibly damaging	Het
Olfr1297	A	T	2: 111,621,504	M190K	probably benign	Het
Papolb	T	A	5: 142,528,541	N449I	possibly damaging	Het
Parn	T	C	16: 13,648,474	K236R	probably benign	Het
Prelid1	G	A	13: 55,322,885	R42Q	probably damaging	Het
Prelp	A	G	1: 133,915,282	F42L	probably benign	Het
Pygo1	C	T	9: 72,945,098	P189L	probably damaging	Het
Rimbp3	T	A	16: 17,213,022	S1437T	probably damaging	Het
Slc37a2	T	A	9: 37,237,430	D252V	probably benign	Het
Socs7	A	G	11: 97,363,339	K233R	probably benign	Het
Stat4	A	G	1: 52,098,478	D476G	possibly damaging	Het
Tesmin	A	G	19: 3,389,077	D43G	probably benign	Het
Thap1	C	A	8: 26,158,474	Y8*	probably null	Het
Tln1	A	G	4: 43,536,397	L1965P	probably damaging	Het
Tmprss11d	A	G	5: 86,309,306	S303P	probably damaging	Het
Tomm40	C	T	7: 19,701,834	V324M	probably damaging	Het
Vmn1r202	A	T	13: 22,501,815	I144K	probably damaging	Het

Other mutations in Hic1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01110:Hic1	APN	11	75165519	missense	possibly damaging	0.96
cough	UTSW	11	75166317	missense	possibly damaging	0.93
Cup	UTSW	11	75167374	missense	probably damaging	0.97
Undulate	UTSW	11	75166216	missense	possibly damaging	0.96
R0138:Hic1	UTSW	11	75167343	missense	probably damaging	0.99
R0331:Hic1	UTSW	11	75165490	missense	possibly damaging	0.53
R0491:Hic1	UTSW	11	75166310	missense	possibly damaging	0.86
R0521:Hic1	UTSW	11	75166887	missense	possibly damaging	0.68
R0744:Hic1	UTSW	11	75165801	missense	possibly damaging	0.52
R1766:Hic1	UTSW	11	75165794	nonsense	probably null
R2070:Hic1	UTSW	11	75169059	missense	possibly damaging	0.68
R2211:Hic1	UTSW	11	75169384	missense	possibly damaging	0.59
R5418:Hic1	UTSW	11	75166599	splice site	probably null
R6047:Hic1	UTSW	11	75166849	missense	possibly damaging	0.94
R6076:Hic1	UTSW	11	75167328	missense	probably damaging	1.00
R6415:Hic1	UTSW	11	75166317	missense	possibly damaging	0.93
R6633:Hic1	UTSW	11	75169498	missense	unknown
R7122:Hic1	UTSW	11	75169230	missense	probably benign
R7308:Hic1	UTSW	11	75167151	missense	probably damaging	1.00
R7761:Hic1	UTSW	11	75167374	missense	probably damaging	0.97
R7778:Hic1	UTSW	11	75166216	missense	possibly damaging	0.96
R7824:Hic1	UTSW	11	75166216	missense	possibly damaging	0.96
R8230:Hic1	UTSW	11	75165585	missense	possibly damaging	0.85
R8752:Hic1	UTSW	11	75169380	missense	probably benign	0.00
R8832:Hic1	UTSW	11	75166902	missense	possibly damaging	0.86
R8857:Hic1	UTSW	11	75165402	missense	probably benign	0.33
R9068:Hic1	UTSW	11	75169506	missense	unknown
R9157:Hic1	UTSW	11	75166227	missense	possibly damaging	0.96
R9497:Hic1	UTSW	11	75169305	missense	possibly damaging	0.92
R9594:Hic1	UTSW	11	75165931	missense	possibly damaging	0.71
RF029:Hic1	UTSW	11	75169442	small deletion	probably benign
RF043:Hic1	UTSW	11	75169455	small deletion	probably benign
Z1186:Hic1	UTSW	11	75167526	missense	probably damaging	0.99
Z1187:Hic1	UTSW	11	75167526	missense	probably damaging	0.99
Z1188:Hic1	UTSW	11	75167526	missense	probably damaging	0.99
Z1189:Hic1	UTSW	11	75167526	missense	probably damaging	0.99
Z1190:Hic1	UTSW	11	75167526	missense	probably damaging	0.99
Z1191:Hic1	UTSW	11	75167526	missense	probably damaging	0.99
Z1191:Hic1	UTSW	11	75169448	frame shift	probably null
Z1191:Hic1	UTSW	11	75169449	frame shift	probably null
Z1191:Hic1	UTSW	11	75169450	small deletion	probably benign
Z1192:Hic1	UTSW	11	75167526	missense	probably damaging	0.99
Z1192:Hic1	UTSW	11	75169450	small deletion	probably benign

Predicted Primers

PCR Primer
(F):5'- TGTAGCTCTTGTCGCAGGAC -3'
(R):5'- GTTATGGCGATGAACTGGTCCG -3'

Sequencing Primer
(F):5'- AGCAGCTCTCCTAGTCCG -3'
(R):5'- ATGAACTGGTCCGGGATCG -3'

Posted On

2020-10-20