Incidental Mutation 'R8419:Parn'
ID 653116
Institutional Source Beutler Lab
Gene Symbol Parn
Ensembl Gene ENSMUSG00000022685
Gene Name poly(A)-specific ribonuclease (deadenylation nuclease)
Synonyms DAN, 1200003I18Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.960) question?
Stock # R8419 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 13537960-13668170 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 13648474 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 236 (K236R)
Ref Sequence ENSEMBL: ENSMUSP00000055969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058884] [ENSMUST00000229042] [ENSMUST00000231003]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000058884
AA Change: K236R

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000055969
Gene: ENSMUSG00000022685
AA Change: K236R

DomainStartEndE-ValueType
Pfam:CAF1 3 383 2.7e-86 PFAM
Pfam:R3H 172 236 2.8e-13 PFAM
Pfam:RNA_bind 430 508 2.2e-37 PFAM
low complexity region 564 578 N/A INTRINSIC
low complexity region 591 606 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229042
Predicted Effect probably benign
Transcript: ENSMUST00000231003
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a 3'-exoribonuclease, with similarity to the RNase D family of 3'-exonucleases. It prefers poly(A) as the substrate, hence, efficiently degrades poly(A) tails of mRNAs. Exonucleolytic degradation of the poly(A) tail is often the first step in the decay of eukaryotic mRNAs. This protein is also involved in silencing of certain maternal mRNAs during oocyte maturation and early embryonic development, as well as in nonsense-mediated decay (NMD) of mRNAs that contain premature stop codons. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik G T 7: 28,143,921 G745C probably damaging Het
9930111J21Rik2 A T 11: 49,019,485 I707N probably damaging Het
Abca14 A G 7: 120,216,266 I246V probably benign Het
Adam19 G A 11: 46,125,023 A337T possibly damaging Het
Ankrd40 G T 11: 94,334,836 G231V probably damaging Het
Arhgap5 G A 12: 52,518,789 V848I probably damaging Het
Bmpr2 G A 1: 59,867,356 R536H probably damaging Het
Casz1 T A 4: 148,948,583 S1310T probably benign Het
Chil1 A T 1: 134,189,542 D367V probably damaging Het
Cltc A G 11: 86,707,566 V990A probably benign Het
Col6a3 A T 1: 90,802,213 S1790R probably damaging Het
Comt C T 16: 18,411,887 W24* probably null Het
Cyp2c70 T C 19: 40,160,580 E374G possibly damaging Het
Dach1 T C 14: 98,168,640 T224A probably damaging Het
Dapk1 G A 13: 60,740,097 E656K probably benign Het
Dicer1 A G 12: 104,702,677 S1249P probably benign Het
Dpp8 A C 9: 65,080,755 I861L probably benign Het
Enam C T 5: 88,503,350 S906L possibly damaging Het
Eral1 A T 11: 78,074,080 I429N possibly damaging Het
Fbxo10 C A 4: 45,041,809 G807C possibly damaging Het
Fsip2 G C 2: 82,978,619 E1761Q probably damaging Het
Ggnbp2 C T 11: 84,837,989 probably null Het
Gm10696 T C 3: 94,175,614 I297V probably benign Het
Gm13088 A G 4: 143,656,427 I74T probably damaging Het
Gm4353 G A 7: 116,083,549 P266S probably benign Het
Gpr84 T C 15: 103,309,536 N38S probably damaging Het
Guca1a A T 17: 47,395,555 I115N probably damaging Het
Hic1 C T 11: 75,166,270 V598M possibly damaging Het
Itga1 A T 13: 115,007,068 I309N probably damaging Het
Itga11 T C 9: 62,755,178 S478P possibly damaging Het
Kctd8 T C 5: 69,340,370 D311G probably damaging Het
Klhl32 T C 4: 24,682,203 E127G possibly damaging Het
Lama2 T A 10: 27,422,563 Y179F probably benign Het
Lamb2 G T 9: 108,488,364 R1382L probably benign Het
Mrpl1 C G 5: 96,226,367 A167G probably benign Het
Muc3 A T 5: 137,146,722 N33K Het
Myt1 A T 2: 181,782,606 R31* probably null Het
Nectin2 T C 7: 19,717,721 T463A probably benign Het
Nectin2 A T 7: 19,738,078 Y129N probably damaging Het
Olfr103 A G 17: 37,336,575 I219T possibly damaging Het
Olfr1297 A T 2: 111,621,504 M190K probably benign Het
Papolb T A 5: 142,528,541 N449I possibly damaging Het
Prelid1 G A 13: 55,322,885 R42Q probably damaging Het
Prelp A G 1: 133,915,282 F42L probably benign Het
Pygo1 C T 9: 72,945,098 P189L probably damaging Het
Rimbp3 T A 16: 17,213,022 S1437T probably damaging Het
Slc37a2 T A 9: 37,237,430 D252V probably benign Het
Socs7 A G 11: 97,363,339 K233R probably benign Het
Stat4 A G 1: 52,098,478 D476G possibly damaging Het
Tesmin A G 19: 3,389,077 D43G probably benign Het
Thap1 C A 8: 26,158,474 Y8* probably null Het
Tln1 A G 4: 43,536,397 L1965P probably damaging Het
Tmprss11d A G 5: 86,309,306 S303P probably damaging Het
Tomm40 C T 7: 19,701,834 V324M probably damaging Het
Vmn1r202 A T 13: 22,501,815 I144K probably damaging Het
Other mutations in Parn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Parn APN 16 13667603 missense probably benign
IGL02030:Parn APN 16 13664650 splice site probably null
IGL02179:Parn APN 16 13667592 missense probably benign 0.00
IGL02336:Parn APN 16 13566703 missense probably damaging 1.00
arlette UTSW 16 13606171 missense probably damaging 1.00
PIT4453001:Parn UTSW 16 13607281 missense probably benign 0.00
PIT4651001:Parn UTSW 16 13631567 missense probably benign 0.25
R0388:Parn UTSW 16 13654476 missense possibly damaging 0.72
R0485:Parn UTSW 16 13654435 splice site probably benign
R0625:Parn UTSW 16 13640294 missense probably benign 0.02
R1104:Parn UTSW 16 13667585 missense probably damaging 0.99
R1299:Parn UTSW 16 13664729 missense probably benign 0.10
R1356:Parn UTSW 16 13650674 nonsense probably null
R2067:Parn UTSW 16 13603069 missense probably damaging 1.00
R2111:Parn UTSW 16 13603069 missense probably damaging 1.00
R2397:Parn UTSW 16 13566654 missense probably benign
R4473:Parn UTSW 16 13664685 missense probably benign 0.00
R4474:Parn UTSW 16 13664685 missense probably benign 0.00
R4475:Parn UTSW 16 13664685 missense probably benign 0.00
R4476:Parn UTSW 16 13664685 missense probably benign 0.00
R4665:Parn UTSW 16 13541103 missense probably benign 0.19
R4795:Parn UTSW 16 13606202 missense probably benign 0.06
R5122:Parn UTSW 16 13654447 critical splice donor site probably null
R5226:Parn UTSW 16 13625552 missense probably benign
R5355:Parn UTSW 16 13668022 missense possibly damaging 0.92
R5570:Parn UTSW 16 13665930 missense probably damaging 0.98
R5979:Parn UTSW 16 13606171 missense probably damaging 1.00
R6009:Parn UTSW 16 13667564 missense probably damaging 1.00
R6173:Parn UTSW 16 13651811 missense possibly damaging 0.82
R6493:Parn UTSW 16 13656925 missense probably damaging 1.00
R7055:Parn UTSW 16 13626134 missense possibly damaging 0.80
R7278:Parn UTSW 16 13626063 splice site probably null
R7391:Parn UTSW 16 13668006 splice site probably null
R7706:Parn UTSW 16 13607253 missense probably damaging 1.00
R8188:Parn UTSW 16 13541156 missense probably benign 0.01
R8317:Parn UTSW 16 13541100 missense probably damaging 0.96
R8326:Parn UTSW 16 13665971 missense probably benign 0.00
R8433:Parn UTSW 16 13667549 missense probably damaging 1.00
R8475:Parn UTSW 16 13607249 critical splice donor site probably null
R8847:Parn UTSW 16 13628406 nonsense probably null
R8958:Parn UTSW 16 13648458 missense possibly damaging 0.64
R8988:Parn UTSW 16 13648417 critical splice donor site probably null
R9277:Parn UTSW 16 13664655 critical splice donor site probably null
R9476:Parn UTSW 16 13541078 missense probably benign 0.10
R9510:Parn UTSW 16 13541078 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TGGGGTAGCTTTACTGTCACAG -3'
(R):5'- CATTGAGATGGTGTCATTGTATCAC -3'

Sequencing Primer
(F):5'- CTGTCAGAGTTAAGAGTGCTACTCC -3'
(R):5'- ATTGTATCACTGAGGCTGTCC -3'
Posted On 2020-10-20