Mutagenetix > Incidental Mutation

Incidental Mutation 'R8419:Parn'

653116

Institutional Source

Beutler Lab

Gene Symbol

Parn

Ensembl Gene

ENSMUSG00000022685

Gene Name

poly(A)-specific ribonuclease (deadenylation nuclease)

Synonyms

DAN, 1200003I18Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.960) question?

Stock #

R8419 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

13537960-13668170 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 13648474 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 236 (K236R)

Ref Sequence

ENSEMBL: ENSMUSP00000055969 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058884] [ENSMUST00000229042] [ENSMUST00000231003]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000058884
AA Change: K236R

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000055969
Gene: ENSMUSG00000022685
AA Change: K236R

Domain	Start	End	E-Value	Type
Pfam:CAF1	3	383	2.7e-86	PFAM
Pfam:R3H	172	236	2.8e-13	PFAM
Pfam:RNA_bind	430	508	2.2e-37	PFAM
low complexity region	564	578	N/A	INTRINSIC
low complexity region	591	606	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000229042

Predicted Effect

probably benign
Transcript: ENSMUST00000231003

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a 3'-exoribonuclease, with similarity to the RNase D family of 3'-exonucleases. It prefers poly(A) as the substrate, hence, efficiently degrades poly(A) tails of mRNAs. Exonucleolytic degradation of the poly(A) tail is often the first step in the decay of eukaryotic mRNAs. This protein is also involved in silencing of certain maternal mRNAs during oocyte maturation and early embryonic development, as well as in nonsense-mediated decay (NMD) of mRNAs that contain premature stop codons. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530053A07Rik	G	T	7: 28,143,921	G745C	probably damaging	Het
9930111J21Rik2	A	T	11: 49,019,485	I707N	probably damaging	Het
Abca14	A	G	7: 120,216,266	I246V	probably benign	Het
Adam19	G	A	11: 46,125,023	A337T	possibly damaging	Het
Ankrd40	G	T	11: 94,334,836	G231V	probably damaging	Het
Arhgap5	G	A	12: 52,518,789	V848I	probably damaging	Het
Bmpr2	G	A	1: 59,867,356	R536H	probably damaging	Het
Casz1	T	A	4: 148,948,583	S1310T	probably benign	Het
Chil1	A	T	1: 134,189,542	D367V	probably damaging	Het
Cltc	A	G	11: 86,707,566	V990A	probably benign	Het
Col6a3	A	T	1: 90,802,213	S1790R	probably damaging	Het
Comt	C	T	16: 18,411,887	W24*	probably null	Het
Cyp2c70	T	C	19: 40,160,580	E374G	possibly damaging	Het
Dach1	T	C	14: 98,168,640	T224A	probably damaging	Het
Dapk1	G	A	13: 60,740,097	E656K	probably benign	Het
Dicer1	A	G	12: 104,702,677	S1249P	probably benign	Het
Dpp8	A	C	9: 65,080,755	I861L	probably benign	Het
Enam	C	T	5: 88,503,350	S906L	possibly damaging	Het
Eral1	A	T	11: 78,074,080	I429N	possibly damaging	Het
Fbxo10	C	A	4: 45,041,809	G807C	possibly damaging	Het
Fsip2	G	C	2: 82,978,619	E1761Q	probably damaging	Het
Ggnbp2	C	T	11: 84,837,989		probably null	Het
Gm10696	T	C	3: 94,175,614	I297V	probably benign	Het
Gm13088	A	G	4: 143,656,427	I74T	probably damaging	Het
Gm4353	G	A	7: 116,083,549	P266S	probably benign	Het
Gpr84	T	C	15: 103,309,536	N38S	probably damaging	Het
Guca1a	A	T	17: 47,395,555	I115N	probably damaging	Het
Hic1	C	T	11: 75,166,270	V598M	possibly damaging	Het
Itga1	A	T	13: 115,007,068	I309N	probably damaging	Het
Itga11	T	C	9: 62,755,178	S478P	possibly damaging	Het
Kctd8	T	C	5: 69,340,370	D311G	probably damaging	Het
Klhl32	T	C	4: 24,682,203	E127G	possibly damaging	Het
Lama2	T	A	10: 27,422,563	Y179F	probably benign	Het
Lamb2	G	T	9: 108,488,364	R1382L	probably benign	Het
Mrpl1	C	G	5: 96,226,367	A167G	probably benign	Het
Muc3	A	T	5: 137,146,722	N33K		Het
Myt1	A	T	2: 181,782,606	R31*	probably null	Het
Nectin2	T	C	7: 19,717,721	T463A	probably benign	Het
Nectin2	A	T	7: 19,738,078	Y129N	probably damaging	Het
Olfr103	A	G	17: 37,336,575	I219T	possibly damaging	Het
Olfr1297	A	T	2: 111,621,504	M190K	probably benign	Het
Papolb	T	A	5: 142,528,541	N449I	possibly damaging	Het
Prelid1	G	A	13: 55,322,885	R42Q	probably damaging	Het
Prelp	A	G	1: 133,915,282	F42L	probably benign	Het
Pygo1	C	T	9: 72,945,098	P189L	probably damaging	Het
Rimbp3	T	A	16: 17,213,022	S1437T	probably damaging	Het
Slc37a2	T	A	9: 37,237,430	D252V	probably benign	Het
Socs7	A	G	11: 97,363,339	K233R	probably benign	Het
Stat4	A	G	1: 52,098,478	D476G	possibly damaging	Het
Tesmin	A	G	19: 3,389,077	D43G	probably benign	Het
Thap1	C	A	8: 26,158,474	Y8*	probably null	Het
Tln1	A	G	4: 43,536,397	L1965P	probably damaging	Het
Tmprss11d	A	G	5: 86,309,306	S303P	probably damaging	Het
Tomm40	C	T	7: 19,701,834	V324M	probably damaging	Het
Vmn1r202	A	T	13: 22,501,815	I144K	probably damaging	Het

Other mutations in Parn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00987:Parn	APN	16	13667603	missense	probably benign
IGL02030:Parn	APN	16	13664650	splice site	probably null
IGL02179:Parn	APN	16	13667592	missense	probably benign	0.00
IGL02336:Parn	APN	16	13566703	missense	probably damaging	1.00
arlette	UTSW	16	13606171	missense	probably damaging	1.00
PIT4453001:Parn	UTSW	16	13607281	missense	probably benign	0.00
PIT4651001:Parn	UTSW	16	13631567	missense	probably benign	0.25
R0388:Parn	UTSW	16	13654476	missense	possibly damaging	0.72
R0485:Parn	UTSW	16	13654435	splice site	probably benign
R0625:Parn	UTSW	16	13640294	missense	probably benign	0.02
R1104:Parn	UTSW	16	13667585	missense	probably damaging	0.99
R1299:Parn	UTSW	16	13664729	missense	probably benign	0.10
R1356:Parn	UTSW	16	13650674	nonsense	probably null
R2067:Parn	UTSW	16	13603069	missense	probably damaging	1.00
R2111:Parn	UTSW	16	13603069	missense	probably damaging	1.00
R2397:Parn	UTSW	16	13566654	missense	probably benign
R4473:Parn	UTSW	16	13664685	missense	probably benign	0.00
R4474:Parn	UTSW	16	13664685	missense	probably benign	0.00
R4475:Parn	UTSW	16	13664685	missense	probably benign	0.00
R4476:Parn	UTSW	16	13664685	missense	probably benign	0.00
R4665:Parn	UTSW	16	13541103	missense	probably benign	0.19
R4795:Parn	UTSW	16	13606202	missense	probably benign	0.06
R5122:Parn	UTSW	16	13654447	critical splice donor site	probably null
R5226:Parn	UTSW	16	13625552	missense	probably benign
R5355:Parn	UTSW	16	13668022	missense	possibly damaging	0.92
R5570:Parn	UTSW	16	13665930	missense	probably damaging	0.98
R5979:Parn	UTSW	16	13606171	missense	probably damaging	1.00
R6009:Parn	UTSW	16	13667564	missense	probably damaging	1.00
R6173:Parn	UTSW	16	13651811	missense	possibly damaging	0.82
R6493:Parn	UTSW	16	13656925	missense	probably damaging	1.00
R7055:Parn	UTSW	16	13626134	missense	possibly damaging	0.80
R7278:Parn	UTSW	16	13626063	splice site	probably null
R7391:Parn	UTSW	16	13668006	splice site	probably null
R7706:Parn	UTSW	16	13607253	missense	probably damaging	1.00
R8188:Parn	UTSW	16	13541156	missense	probably benign	0.01
R8317:Parn	UTSW	16	13541100	missense	probably damaging	0.96
R8326:Parn	UTSW	16	13665971	missense	probably benign	0.00
R8433:Parn	UTSW	16	13667549	missense	probably damaging	1.00
R8475:Parn	UTSW	16	13607249	critical splice donor site	probably null
R8847:Parn	UTSW	16	13628406	nonsense	probably null
R8958:Parn	UTSW	16	13648458	missense	possibly damaging	0.64
R8988:Parn	UTSW	16	13648417	critical splice donor site	probably null
R9277:Parn	UTSW	16	13664655	critical splice donor site	probably null
R9476:Parn	UTSW	16	13541078	missense	probably benign	0.10
R9510:Parn	UTSW	16	13541078	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- TGGGGTAGCTTTACTGTCACAG -3'
(R):5'- CATTGAGATGGTGTCATTGTATCAC -3'

Sequencing Primer
(F):5'- CTGTCAGAGTTAAGAGTGCTACTCC -3'
(R):5'- ATTGTATCACTGAGGCTGTCC -3'

Posted On

2020-10-20