Incidental Mutation 'R8419:Rimbp3'
ID 653117
Institutional Source Beutler Lab
Gene Symbol Rimbp3
Ensembl Gene ENSMUSG00000071636
Gene Name RIMS binding protein 3
Synonyms RIM-BP3, LOC239731, LOC385766
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.247) question?
Stock # R8419 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 17208603-17213982 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 17213022 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 1437 (S1437T)
Ref Sequence ENSEMBL: ENSMUSP00000127909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169803]
AlphaFold Q3V0F0
Predicted Effect probably damaging
Transcript: ENSMUST00000169803
AA Change: S1437T

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000127909
Gene: ENSMUSG00000071636
AA Change: S1437T

DomainStartEndE-ValueType
coiled coil region 25 56 N/A INTRINSIC
coiled coil region 84 145 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
coiled coil region 395 431 N/A INTRINSIC
coiled coil region 547 610 N/A INTRINSIC
low complexity region 688 701 N/A INTRINSIC
low complexity region 769 780 N/A INTRINSIC
SH3 825 888 7.58e-8 SMART
low complexity region 913 924 N/A INTRINSIC
FN3 980 1052 2.21e-3 SMART
FN3 1073 1160 1.91e1 SMART
low complexity region 1236 1243 N/A INTRINSIC
SH3 1423 1487 5.08e-2 SMART
SH3 1539 1602 5.97e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male mice homozygous for a null mutation display infertility with impaired spermiogenesis and defects in sperm head and flagellum morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik G T 7: 28,143,921 G745C probably damaging Het
9930111J21Rik2 A T 11: 49,019,485 I707N probably damaging Het
Abca14 A G 7: 120,216,266 I246V probably benign Het
Adam19 G A 11: 46,125,023 A337T possibly damaging Het
Ankrd40 G T 11: 94,334,836 G231V probably damaging Het
Arhgap5 G A 12: 52,518,789 V848I probably damaging Het
Bmpr2 G A 1: 59,867,356 R536H probably damaging Het
Casz1 T A 4: 148,948,583 S1310T probably benign Het
Chil1 A T 1: 134,189,542 D367V probably damaging Het
Cltc A G 11: 86,707,566 V990A probably benign Het
Col6a3 A T 1: 90,802,213 S1790R probably damaging Het
Comt C T 16: 18,411,887 W24* probably null Het
Cyp2c70 T C 19: 40,160,580 E374G possibly damaging Het
Dach1 T C 14: 98,168,640 T224A probably damaging Het
Dapk1 G A 13: 60,740,097 E656K probably benign Het
Dicer1 A G 12: 104,702,677 S1249P probably benign Het
Dpp8 A C 9: 65,080,755 I861L probably benign Het
Enam C T 5: 88,503,350 S906L possibly damaging Het
Eral1 A T 11: 78,074,080 I429N possibly damaging Het
Fbxo10 C A 4: 45,041,809 G807C possibly damaging Het
Fsip2 G C 2: 82,978,619 E1761Q probably damaging Het
Ggnbp2 C T 11: 84,837,989 probably null Het
Gm10696 T C 3: 94,175,614 I297V probably benign Het
Gm13088 A G 4: 143,656,427 I74T probably damaging Het
Gm4353 G A 7: 116,083,549 P266S probably benign Het
Gpr84 T C 15: 103,309,536 N38S probably damaging Het
Guca1a A T 17: 47,395,555 I115N probably damaging Het
Hic1 C T 11: 75,166,270 V598M possibly damaging Het
Itga1 A T 13: 115,007,068 I309N probably damaging Het
Itga11 T C 9: 62,755,178 S478P possibly damaging Het
Kctd8 T C 5: 69,340,370 D311G probably damaging Het
Klhl32 T C 4: 24,682,203 E127G possibly damaging Het
Lama2 T A 10: 27,422,563 Y179F probably benign Het
Lamb2 G T 9: 108,488,364 R1382L probably benign Het
Mrpl1 C G 5: 96,226,367 A167G probably benign Het
Muc3 A T 5: 137,146,722 N33K Het
Myt1 A T 2: 181,782,606 R31* probably null Het
Nectin2 T C 7: 19,717,721 T463A probably benign Het
Nectin2 A T 7: 19,738,078 Y129N probably damaging Het
Olfr103 A G 17: 37,336,575 I219T possibly damaging Het
Olfr1297 A T 2: 111,621,504 M190K probably benign Het
Papolb T A 5: 142,528,541 N449I possibly damaging Het
Parn T C 16: 13,648,474 K236R probably benign Het
Prelid1 G A 13: 55,322,885 R42Q probably damaging Het
Prelp A G 1: 133,915,282 F42L probably benign Het
Pygo1 C T 9: 72,945,098 P189L probably damaging Het
Slc37a2 T A 9: 37,237,430 D252V probably benign Het
Socs7 A G 11: 97,363,339 K233R probably benign Het
Stat4 A G 1: 52,098,478 D476G possibly damaging Het
Tesmin A G 19: 3,389,077 D43G probably benign Het
Thap1 C A 8: 26,158,474 Y8* probably null Het
Tln1 A G 4: 43,536,397 L1965P probably damaging Het
Tmprss11d A G 5: 86,309,306 S303P probably damaging Het
Tomm40 C T 7: 19,701,834 V324M probably damaging Het
Vmn1r202 A T 13: 22,501,815 I144K probably damaging Het
Other mutations in Rimbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Rimbp3 APN 16 17209743 missense probably benign 0.01
IGL00786:Rimbp3 APN 16 17211688 missense probably damaging 0.99
IGL01411:Rimbp3 APN 16 17211094 missense probably damaging 1.00
IGL01434:Rimbp3 APN 16 17211702 missense probably benign 0.13
IGL01895:Rimbp3 APN 16 17211436 missense probably damaging 0.99
IGL02322:Rimbp3 APN 16 17211615 missense probably benign 0.00
IGL02649:Rimbp3 APN 16 17209608 nonsense probably null
IGL03285:Rimbp3 APN 16 17213232 missense probably benign 0.16
PIT4581001:Rimbp3 UTSW 16 17210716 missense possibly damaging 0.76
R0279:Rimbp3 UTSW 16 17209453 missense probably benign 0.00
R0465:Rimbp3 UTSW 16 17211780 missense possibly damaging 0.86
R0605:Rimbp3 UTSW 16 17211699 missense probably damaging 0.99
R0674:Rimbp3 UTSW 16 17212737 missense probably benign 0.02
R1676:Rimbp3 UTSW 16 17211113 missense probably benign 0.13
R1780:Rimbp3 UTSW 16 17212632 missense probably benign
R1946:Rimbp3 UTSW 16 17210427 missense probably benign 0.10
R2113:Rimbp3 UTSW 16 17209675 missense probably benign 0.00
R3847:Rimbp3 UTSW 16 17210299 missense probably benign 0.13
R3849:Rimbp3 UTSW 16 17210299 missense probably benign 0.13
R3850:Rimbp3 UTSW 16 17210299 missense probably benign 0.13
R4355:Rimbp3 UTSW 16 17209692 missense possibly damaging 0.56
R4646:Rimbp3 UTSW 16 17213098 missense probably damaging 0.99
R4669:Rimbp3 UTSW 16 17209189 missense possibly damaging 0.88
R4732:Rimbp3 UTSW 16 17210601 missense possibly damaging 0.94
R4733:Rimbp3 UTSW 16 17210601 missense possibly damaging 0.94
R5025:Rimbp3 UTSW 16 17209807 missense probably damaging 0.99
R5039:Rimbp3 UTSW 16 17213331 missense probably damaging 0.99
R5177:Rimbp3 UTSW 16 17209917 missense possibly damaging 0.85
R5311:Rimbp3 UTSW 16 17210844 missense probably benign 0.00
R5942:Rimbp3 UTSW 16 17211888 missense probably benign 0.00
R6063:Rimbp3 UTSW 16 17210917 missense probably damaging 1.00
R6092:Rimbp3 UTSW 16 17212270 missense probably damaging 1.00
R6126:Rimbp3 UTSW 16 17212276 missense probably benign 0.25
R6288:Rimbp3 UTSW 16 17212908 missense probably benign 0.22
R6446:Rimbp3 UTSW 16 17212929 missense probably benign 0.00
R6773:Rimbp3 UTSW 16 17209015 missense probably damaging 1.00
R7017:Rimbp3 UTSW 16 17209746 missense probably benign 0.04
R7043:Rimbp3 UTSW 16 17211108 missense probably damaging 1.00
R7048:Rimbp3 UTSW 16 17210326 missense probably benign 0.20
R7378:Rimbp3 UTSW 16 17211204 missense probably benign
R7440:Rimbp3 UTSW 16 17213201 missense possibly damaging 0.78
R7788:Rimbp3 UTSW 16 17212704 missense probably benign 0.00
R7879:Rimbp3 UTSW 16 17211046 missense possibly damaging 0.71
R8071:Rimbp3 UTSW 16 17210863 missense probably benign
R8272:Rimbp3 UTSW 16 17209105 missense possibly damaging 0.85
R8819:Rimbp3 UTSW 16 17210907 missense probably benign 0.17
R8830:Rimbp3 UTSW 16 17209006 missense probably damaging 0.98
R8936:Rimbp3 UTSW 16 17213020 missense probably benign
R8982:Rimbp3 UTSW 16 17209647 missense probably benign 0.11
R9365:Rimbp3 UTSW 16 17208756 missense possibly damaging 0.93
Z1176:Rimbp3 UTSW 16 17209474 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GTTTGGATTCTCAGGGCACAG -3'
(R):5'- TCAGTCTGTTGTGTGCCCAC -3'

Sequencing Primer
(F):5'- TTCTCAGGGCACAGAGAAGCC -3'
(R):5'- CCTCTACCTCAACTACCAGGTG -3'
Posted On 2020-10-20