Incidental Mutation 'R8419:Rimbp3'
ID 653117
Institutional Source Beutler Lab
Gene Symbol Rimbp3
Ensembl Gene ENSMUSG00000071636
Gene Name RIMS binding protein 3
Synonyms LOC239731, LOC385766, RIM-BP3
MMRRC Submission 067772-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.201) question?
Stock # R8419 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 17026467-17031846 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 17030886 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 1437 (S1437T)
Ref Sequence ENSEMBL: ENSMUSP00000127909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169803]
AlphaFold Q3V0F0
Predicted Effect probably damaging
Transcript: ENSMUST00000169803
AA Change: S1437T

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000127909
Gene: ENSMUSG00000071636
AA Change: S1437T

DomainStartEndE-ValueType
coiled coil region 25 56 N/A INTRINSIC
coiled coil region 84 145 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
coiled coil region 395 431 N/A INTRINSIC
coiled coil region 547 610 N/A INTRINSIC
low complexity region 688 701 N/A INTRINSIC
low complexity region 769 780 N/A INTRINSIC
SH3 825 888 7.58e-8 SMART
low complexity region 913 924 N/A INTRINSIC
FN3 980 1052 2.21e-3 SMART
FN3 1073 1160 1.91e1 SMART
low complexity region 1236 1243 N/A INTRINSIC
SH3 1423 1487 5.08e-2 SMART
SH3 1539 1602 5.97e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male mice homozygous for a null mutation display infertility with impaired spermiogenesis and defects in sperm head and flagellum morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 A T 11: 48,910,312 (GRCm39) I707N probably damaging Het
Abca14 A G 7: 119,815,489 (GRCm39) I246V probably benign Het
Adam19 G A 11: 46,015,850 (GRCm39) A337T possibly damaging Het
Ankrd40 G T 11: 94,225,662 (GRCm39) G231V probably damaging Het
Arhgap5 G A 12: 52,565,572 (GRCm39) V848I probably damaging Het
Bmpr2 G A 1: 59,906,515 (GRCm39) R536H probably damaging Het
Casz1 T A 4: 149,033,040 (GRCm39) S1310T probably benign Het
Chi3l1 A T 1: 134,117,280 (GRCm39) D367V probably damaging Het
Cltc A G 11: 86,598,392 (GRCm39) V990A probably benign Het
Col6a3 A T 1: 90,729,935 (GRCm39) S1790R probably damaging Het
Comt C T 16: 18,230,637 (GRCm39) W24* probably null Het
Cyp2c70 T C 19: 40,149,024 (GRCm39) E374G possibly damaging Het
Dach1 T C 14: 98,406,076 (GRCm39) T224A probably damaging Het
Dapk1 G A 13: 60,887,911 (GRCm39) E656K probably benign Het
Dicer1 A G 12: 104,668,936 (GRCm39) S1249P probably benign Het
Dpp8 A C 9: 64,988,037 (GRCm39) I861L probably benign Het
Enam C T 5: 88,651,209 (GRCm39) S906L possibly damaging Het
Eral1 A T 11: 77,964,906 (GRCm39) I429N possibly damaging Het
Fbxo10 C A 4: 45,041,809 (GRCm39) G807C possibly damaging Het
Fcgbpl1 G T 7: 27,843,346 (GRCm39) G745C probably damaging Het
Fsip2 G C 2: 82,808,963 (GRCm39) E1761Q probably damaging Het
Ggnbp2 C T 11: 84,728,815 (GRCm39) probably null Het
Gm4353 G A 7: 115,682,784 (GRCm39) P266S probably benign Het
Gpr84 T C 15: 103,217,963 (GRCm39) N38S probably damaging Het
Guca1a A T 17: 47,706,480 (GRCm39) I115N probably damaging Het
Hic1 C T 11: 75,057,096 (GRCm39) V598M possibly damaging Het
Itga1 A T 13: 115,143,604 (GRCm39) I309N probably damaging Het
Itga11 T C 9: 62,662,460 (GRCm39) S478P possibly damaging Het
Kctd8 T C 5: 69,497,713 (GRCm39) D311G probably damaging Het
Klhl32 T C 4: 24,682,203 (GRCm39) E127G possibly damaging Het
Lama2 T A 10: 27,298,559 (GRCm39) Y179F probably benign Het
Lamb2 G T 9: 108,365,563 (GRCm39) R1382L probably benign Het
Mrpl1 C G 5: 96,374,226 (GRCm39) A167G probably benign Het
Muc17 A T 5: 137,175,570 (GRCm39) N33K Het
Myt1 A T 2: 181,424,399 (GRCm39) R31* probably null Het
Nectin2 T C 7: 19,451,646 (GRCm39) T463A probably benign Het
Nectin2 A T 7: 19,472,003 (GRCm39) Y129N probably damaging Het
Or12d13 A G 17: 37,647,466 (GRCm39) I219T possibly damaging Het
Or4k47 A T 2: 111,451,849 (GRCm39) M190K probably benign Het
Papolb T A 5: 142,514,296 (GRCm39) N449I possibly damaging Het
Parn T C 16: 13,466,338 (GRCm39) K236R probably benign Het
Pramel22 A G 4: 143,382,997 (GRCm39) I74T probably damaging Het
Prelid1 G A 13: 55,470,698 (GRCm39) R42Q probably damaging Het
Prelp A G 1: 133,843,020 (GRCm39) F42L probably benign Het
Pygo1 C T 9: 72,852,380 (GRCm39) P189L probably damaging Het
Slc37a2 T A 9: 37,148,726 (GRCm39) D252V probably benign Het
Socs7 A G 11: 97,254,165 (GRCm39) K233R probably benign Het
Spopfm2 T C 3: 94,082,921 (GRCm39) I297V probably benign Het
Stat4 A G 1: 52,137,637 (GRCm39) D476G possibly damaging Het
Tesmin A G 19: 3,439,077 (GRCm39) D43G probably benign Het
Thap1 C A 8: 26,648,502 (GRCm39) Y8* probably null Het
Tln1 A G 4: 43,536,397 (GRCm39) L1965P probably damaging Het
Tmprss11d A G 5: 86,457,165 (GRCm39) S303P probably damaging Het
Tomm40 C T 7: 19,435,759 (GRCm39) V324M probably damaging Het
Vmn1r202 A T 13: 22,685,985 (GRCm39) I144K probably damaging Het
Other mutations in Rimbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Rimbp3 APN 16 17,027,607 (GRCm39) missense probably benign 0.01
IGL00786:Rimbp3 APN 16 17,029,552 (GRCm39) missense probably damaging 0.99
IGL01411:Rimbp3 APN 16 17,028,958 (GRCm39) missense probably damaging 1.00
IGL01434:Rimbp3 APN 16 17,029,566 (GRCm39) missense probably benign 0.13
IGL01895:Rimbp3 APN 16 17,029,300 (GRCm39) missense probably damaging 0.99
IGL02322:Rimbp3 APN 16 17,029,479 (GRCm39) missense probably benign 0.00
IGL02649:Rimbp3 APN 16 17,027,472 (GRCm39) nonsense probably null
IGL03285:Rimbp3 APN 16 17,031,096 (GRCm39) missense probably benign 0.16
PIT4581001:Rimbp3 UTSW 16 17,028,580 (GRCm39) missense possibly damaging 0.76
R0279:Rimbp3 UTSW 16 17,027,317 (GRCm39) missense probably benign 0.00
R0465:Rimbp3 UTSW 16 17,029,644 (GRCm39) missense possibly damaging 0.86
R0605:Rimbp3 UTSW 16 17,029,563 (GRCm39) missense probably damaging 0.99
R0674:Rimbp3 UTSW 16 17,030,601 (GRCm39) missense probably benign 0.02
R1676:Rimbp3 UTSW 16 17,028,977 (GRCm39) missense probably benign 0.13
R1780:Rimbp3 UTSW 16 17,030,496 (GRCm39) missense probably benign
R1946:Rimbp3 UTSW 16 17,028,291 (GRCm39) missense probably benign 0.10
R2113:Rimbp3 UTSW 16 17,027,539 (GRCm39) missense probably benign 0.00
R3847:Rimbp3 UTSW 16 17,028,163 (GRCm39) missense probably benign 0.13
R3849:Rimbp3 UTSW 16 17,028,163 (GRCm39) missense probably benign 0.13
R3850:Rimbp3 UTSW 16 17,028,163 (GRCm39) missense probably benign 0.13
R4355:Rimbp3 UTSW 16 17,027,556 (GRCm39) missense possibly damaging 0.56
R4646:Rimbp3 UTSW 16 17,030,962 (GRCm39) missense probably damaging 0.99
R4669:Rimbp3 UTSW 16 17,027,053 (GRCm39) missense possibly damaging 0.88
R4732:Rimbp3 UTSW 16 17,028,465 (GRCm39) missense possibly damaging 0.94
R4733:Rimbp3 UTSW 16 17,028,465 (GRCm39) missense possibly damaging 0.94
R5025:Rimbp3 UTSW 16 17,027,671 (GRCm39) missense probably damaging 0.99
R5039:Rimbp3 UTSW 16 17,031,195 (GRCm39) missense probably damaging 0.99
R5177:Rimbp3 UTSW 16 17,027,781 (GRCm39) missense possibly damaging 0.85
R5311:Rimbp3 UTSW 16 17,028,708 (GRCm39) missense probably benign 0.00
R5942:Rimbp3 UTSW 16 17,029,752 (GRCm39) missense probably benign 0.00
R6063:Rimbp3 UTSW 16 17,028,781 (GRCm39) missense probably damaging 1.00
R6092:Rimbp3 UTSW 16 17,030,134 (GRCm39) missense probably damaging 1.00
R6126:Rimbp3 UTSW 16 17,030,140 (GRCm39) missense probably benign 0.25
R6288:Rimbp3 UTSW 16 17,030,772 (GRCm39) missense probably benign 0.22
R6446:Rimbp3 UTSW 16 17,030,793 (GRCm39) missense probably benign 0.00
R6773:Rimbp3 UTSW 16 17,026,879 (GRCm39) missense probably damaging 1.00
R7017:Rimbp3 UTSW 16 17,027,610 (GRCm39) missense probably benign 0.04
R7043:Rimbp3 UTSW 16 17,028,972 (GRCm39) missense probably damaging 1.00
R7048:Rimbp3 UTSW 16 17,028,190 (GRCm39) missense probably benign 0.20
R7378:Rimbp3 UTSW 16 17,029,068 (GRCm39) missense probably benign
R7440:Rimbp3 UTSW 16 17,031,065 (GRCm39) missense possibly damaging 0.78
R7788:Rimbp3 UTSW 16 17,030,568 (GRCm39) missense probably benign 0.00
R7879:Rimbp3 UTSW 16 17,028,910 (GRCm39) missense possibly damaging 0.71
R8071:Rimbp3 UTSW 16 17,028,727 (GRCm39) missense probably benign
R8272:Rimbp3 UTSW 16 17,026,969 (GRCm39) missense possibly damaging 0.85
R8819:Rimbp3 UTSW 16 17,028,771 (GRCm39) missense probably benign 0.17
R8830:Rimbp3 UTSW 16 17,026,870 (GRCm39) missense probably damaging 0.98
R8936:Rimbp3 UTSW 16 17,030,884 (GRCm39) missense probably benign
R8982:Rimbp3 UTSW 16 17,027,511 (GRCm39) missense probably benign 0.11
R9365:Rimbp3 UTSW 16 17,026,620 (GRCm39) missense possibly damaging 0.93
R9799:Rimbp3 UTSW 16 17,027,641 (GRCm39) missense possibly damaging 0.88
Z1176:Rimbp3 UTSW 16 17,027,338 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GTTTGGATTCTCAGGGCACAG -3'
(R):5'- TCAGTCTGTTGTGTGCCCAC -3'

Sequencing Primer
(F):5'- TTCTCAGGGCACAGAGAAGCC -3'
(R):5'- CCTCTACCTCAACTACCAGGTG -3'
Posted On 2020-10-20