Mutagenetix > Incidental Mutation

Incidental Mutation 'R8419:Rimbp3'

653117

Institutional Source

Beutler Lab

Gene Symbol

Rimbp3

Ensembl Gene

ENSMUSG00000071636

Gene Name

RIMS binding protein 3

Synonyms

RIM-BP3, LOC239731, LOC385766

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.257) question?

Stock #

R8419 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

17208603-17213982 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 17213022 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 1437 (S1437T)

Ref Sequence

ENSEMBL: ENSMUSP00000127909 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169803]

AlphaFold

Q3V0F0

Predicted Effect

probably damaging
Transcript: ENSMUST00000169803
AA Change: S1437T

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000127909
Gene: ENSMUSG00000071636
AA Change: S1437T

Domain	Start	End	E-Value	Type
coiled coil region	25	56	N/A	INTRINSIC
coiled coil region	84	145	N/A	INTRINSIC
low complexity region	308	324	N/A	INTRINSIC
coiled coil region	395	431	N/A	INTRINSIC
coiled coil region	547	610	N/A	INTRINSIC
low complexity region	688	701	N/A	INTRINSIC
low complexity region	769	780	N/A	INTRINSIC
SH3	825	888	7.58e-8	SMART
low complexity region	913	924	N/A	INTRINSIC
FN3	980	1052	2.21e-3	SMART
FN3	1073	1160	1.91e1	SMART
low complexity region	1236	1243	N/A	INTRINSIC
SH3	1423	1487	5.08e-2	SMART
SH3	1539	1602	5.97e-6	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.5%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Male mice homozygous for a null mutation display infertility with impaired spermiogenesis and defects in sperm head and flagellum morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530053A07Rik	G	T	7: 28,143,921	G745C	probably damaging	Het
9930111J21Rik2	A	T	11: 49,019,485	I707N	probably damaging	Het
Abca14	A	G	7: 120,216,266	I246V	probably benign	Het
Adam19	G	A	11: 46,125,023	A337T	possibly damaging	Het
Ankrd40	G	T	11: 94,334,836	G231V	probably damaging	Het
Arhgap5	G	A	12: 52,518,789	V848I	probably damaging	Het
Bmpr2	G	A	1: 59,867,356	R536H	probably damaging	Het
Casz1	T	A	4: 148,948,583	S1310T	probably benign	Het
Chil1	A	T	1: 134,189,542	D367V	probably damaging	Het
Cltc	A	G	11: 86,707,566	V990A	probably benign	Het
Col6a3	A	T	1: 90,802,213	S1790R	probably damaging	Het
Comt	C	T	16: 18,411,887	W24*	probably null	Het
Cyp2c70	T	C	19: 40,160,580	E374G	possibly damaging	Het
Dach1	T	C	14: 98,168,640	T224A	probably damaging	Het
Dapk1	G	A	13: 60,740,097	E656K	probably benign	Het
Dicer1	A	G	12: 104,702,677	S1249P	probably benign	Het
Dpp8	A	C	9: 65,080,755	I861L	probably benign	Het
Enam	C	T	5: 88,503,350	S906L	possibly damaging	Het
Eral1	A	T	11: 78,074,080	I429N	possibly damaging	Het
Fbxo10	C	A	4: 45,041,809	G807C	possibly damaging	Het
Fsip2	G	C	2: 82,978,619	E1761Q	probably damaging	Het
Ggnbp2	C	T	11: 84,837,989		probably null	Het
Gm10696	T	C	3: 94,175,614	I297V	probably benign	Het
Gm13088	A	G	4: 143,656,427	I74T	probably damaging	Het
Gm4353	G	A	7: 116,083,549	P266S	probably benign	Het
Gpr84	T	C	15: 103,309,536	N38S	probably damaging	Het
Guca1a	A	T	17: 47,395,555	I115N	probably damaging	Het
Hic1	C	T	11: 75,166,270	V598M	possibly damaging	Het
Itga1	A	T	13: 115,007,068	I309N	probably damaging	Het
Itga11	T	C	9: 62,755,178	S478P	possibly damaging	Het
Kctd8	T	C	5: 69,340,370	D311G	probably damaging	Het
Klhl32	T	C	4: 24,682,203	E127G	possibly damaging	Het
Lama2	T	A	10: 27,422,563	Y179F	probably benign	Het
Lamb2	G	T	9: 108,488,364	R1382L	probably benign	Het
Mrpl1	C	G	5: 96,226,367	A167G	probably benign	Het
Muc3	A	T	5: 137,146,722	N33K		Het
Myt1	A	T	2: 181,782,606	R31*	probably null	Het
Nectin2	T	C	7: 19,717,721	T463A	probably benign	Het
Nectin2	A	T	7: 19,738,078	Y129N	probably damaging	Het
Olfr103	A	G	17: 37,336,575	I219T	possibly damaging	Het
Olfr1297	A	T	2: 111,621,504	M190K	probably benign	Het
Papolb	T	A	5: 142,528,541	N449I	possibly damaging	Het
Parn	T	C	16: 13,648,474	K236R	probably benign	Het
Prelid1	G	A	13: 55,322,885	R42Q	probably damaging	Het
Prelp	A	G	1: 133,915,282	F42L	probably benign	Het
Pygo1	C	T	9: 72,945,098	P189L	probably damaging	Het
Slc37a2	T	A	9: 37,237,430	D252V	probably benign	Het
Socs7	A	G	11: 97,363,339	K233R	probably benign	Het
Stat4	A	G	1: 52,098,478	D476G	possibly damaging	Het
Tesmin	A	G	19: 3,389,077	D43G	probably benign	Het
Thap1	C	A	8: 26,158,474	Y8*	probably null	Het
Tln1	A	G	4: 43,536,397	L1965P	probably damaging	Het
Tmprss11d	A	G	5: 86,309,306	S303P	probably damaging	Het
Tomm40	C	T	7: 19,701,834	V324M	probably damaging	Het
Vmn1r202	A	T	13: 22,501,815	I144K	probably damaging	Het

Other mutations in Rimbp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Rimbp3	APN	16	17209743	missense	probably benign	0.01
IGL00786:Rimbp3	APN	16	17211688	missense	probably damaging	0.99
IGL01411:Rimbp3	APN	16	17211094	missense	probably damaging	1.00
IGL01434:Rimbp3	APN	16	17211702	missense	probably benign	0.13
IGL01895:Rimbp3	APN	16	17211436	missense	probably damaging	0.99
IGL02322:Rimbp3	APN	16	17211615	missense	probably benign	0.00
IGL02649:Rimbp3	APN	16	17209608	nonsense	probably null
IGL03285:Rimbp3	APN	16	17213232	missense	probably benign	0.16
PIT4581001:Rimbp3	UTSW	16	17210716	missense	possibly damaging	0.76
R0279:Rimbp3	UTSW	16	17209453	missense	probably benign	0.00
R0465:Rimbp3	UTSW	16	17211780	missense	possibly damaging	0.86
R0605:Rimbp3	UTSW	16	17211699	missense	probably damaging	0.99
R0674:Rimbp3	UTSW	16	17212737	missense	probably benign	0.02
R1676:Rimbp3	UTSW	16	17211113	missense	probably benign	0.13
R1780:Rimbp3	UTSW	16	17212632	missense	probably benign
R1946:Rimbp3	UTSW	16	17210427	missense	probably benign	0.10
R2113:Rimbp3	UTSW	16	17209675	missense	probably benign	0.00
R3847:Rimbp3	UTSW	16	17210299	missense	probably benign	0.13
R3849:Rimbp3	UTSW	16	17210299	missense	probably benign	0.13
R3850:Rimbp3	UTSW	16	17210299	missense	probably benign	0.13
R4355:Rimbp3	UTSW	16	17209692	missense	possibly damaging	0.56
R4646:Rimbp3	UTSW	16	17213098	missense	probably damaging	0.99
R4669:Rimbp3	UTSW	16	17209189	missense	possibly damaging	0.88
R4732:Rimbp3	UTSW	16	17210601	missense	possibly damaging	0.94
R4733:Rimbp3	UTSW	16	17210601	missense	possibly damaging	0.94
R5025:Rimbp3	UTSW	16	17209807	missense	probably damaging	0.99
R5039:Rimbp3	UTSW	16	17213331	missense	probably damaging	0.99
R5177:Rimbp3	UTSW	16	17209917	missense	possibly damaging	0.85
R5311:Rimbp3	UTSW	16	17210844	missense	probably benign	0.00
R5942:Rimbp3	UTSW	16	17211888	missense	probably benign	0.00
R6063:Rimbp3	UTSW	16	17210917	missense	probably damaging	1.00
R6092:Rimbp3	UTSW	16	17212270	missense	probably damaging	1.00
R6126:Rimbp3	UTSW	16	17212276	missense	probably benign	0.25
R6288:Rimbp3	UTSW	16	17212908	missense	probably benign	0.22
R6446:Rimbp3	UTSW	16	17212929	missense	probably benign	0.00
R6773:Rimbp3	UTSW	16	17209015	missense	probably damaging	1.00
R7017:Rimbp3	UTSW	16	17209746	missense	probably benign	0.04
R7043:Rimbp3	UTSW	16	17211108	missense	probably damaging	1.00
R7048:Rimbp3	UTSW	16	17210326	missense	probably benign	0.20
R7378:Rimbp3	UTSW	16	17211204	missense	probably benign
R7440:Rimbp3	UTSW	16	17213201	missense	possibly damaging	0.78
R7788:Rimbp3	UTSW	16	17212704	missense	probably benign	0.00
R7879:Rimbp3	UTSW	16	17211046	missense	possibly damaging	0.71
R8071:Rimbp3	UTSW	16	17210863	missense	probably benign
R8272:Rimbp3	UTSW	16	17209105	missense	possibly damaging	0.85
R8819:Rimbp3	UTSW	16	17210907	missense	probably benign	0.17
R8830:Rimbp3	UTSW	16	17209006	missense	probably damaging	0.98
R8936:Rimbp3	UTSW	16	17213020	missense	probably benign
R8982:Rimbp3	UTSW	16	17209647	missense	probably benign	0.11
R9365:Rimbp3	UTSW	16	17208756	missense	possibly damaging	0.93
R9799:Rimbp3	UTSW	16	17209777	missense	possibly damaging	0.88
Z1176:Rimbp3	UTSW	16	17209474	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- GTTTGGATTCTCAGGGCACAG -3'
(R):5'- TCAGTCTGTTGTGTGCCCAC -3'

Sequencing Primer
(F):5'- TTCTCAGGGCACAGAGAAGCC -3'
(R):5'- CCTCTACCTCAACTACCAGGTG -3'

Posted On

2020-10-20