Incidental Mutation 'R8420:Ptgfr'
ID 653134
Institutional Source Beutler Lab
Gene Symbol Ptgfr
Ensembl Gene ENSMUSG00000028036
Gene Name prostaglandin F receptor
Synonyms FP, PGF
MMRRC Submission 067773-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.091) question?
Stock # R8420 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 151504247-151543165 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 151541053 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 152 (V152M)
Ref Sequence ENSEMBL: ENSMUSP00000029670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029670] [ENSMUST00000106126]
AlphaFold P43117
Predicted Effect possibly damaging
Transcript: ENSMUST00000029670
AA Change: V152M

PolyPhen 2 Score 0.486 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000029670
Gene: ENSMUSG00000028036
AA Change: V152M

DomainStartEndE-ValueType
Pfam:7tm_1 23 304 6.8e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106126
AA Change: V152M

PolyPhen 2 Score 0.486 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101732
Gene: ENSMUSG00000028036
AA Change: V152M

DomainStartEndE-ValueType
Pfam:7tm_1 43 304 7.6e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is member of the G-protein coupled receptor family. This protein is a receptor for prostaglandin F2-alpha (PGF2-alpha), which is known to be a potent luteolytic agent, and may also be involved in modulating intraocular pressure and smooth muscle contraction in uterus. Knockout studies in mice suggest that the interaction of PGF2-alpha with this receptor may initiate parturition in ovarian luteal cells and thus induce luteolysis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Pregnant females homozygous for a targeted null mutation are unable to deliver their offspring due to lack of induction of the oxytocin receptor and fail to show the normal decline of serum progesterone levels preceding parturition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 119,937,746 (GRCm39) S11P unknown Het
Adrb2 T C 18: 62,312,004 (GRCm39) T274A probably damaging Het
Aph1b A G 9: 66,701,503 (GRCm39) S45P probably damaging Het
Atp9b A T 18: 80,887,806 (GRCm39) D321E Het
C1qbp A G 11: 70,869,543 (GRCm39) V180A possibly damaging Het
C4b G T 17: 34,953,513 (GRCm39) A990D probably damaging Het
Ccdc80 T A 16: 44,915,612 (GRCm39) S123T possibly damaging Het
Cdh18 A C 15: 23,474,138 (GRCm39) E669D possibly damaging Het
Ceacam3 T A 7: 16,895,608 (GRCm39) V526D Het
Cenpf C T 1: 189,404,782 (GRCm39) C349Y probably damaging Het
Dmrt2 T C 19: 25,655,379 (GRCm39) V326A probably damaging Het
Dock9 T C 14: 121,783,454 (GRCm39) Q2023R probably damaging Het
Exd2 A G 12: 80,522,771 (GRCm39) R77G probably benign Het
Exph5 A T 9: 53,287,148 (GRCm39) K1410* probably null Het
Eya2 A G 2: 165,608,988 (GRCm39) T443A probably damaging Het
Fam135a G A 1: 24,067,569 (GRCm39) T1100M probably benign Het
Foxp2 G T 6: 15,403,866 (GRCm39) R381L unknown Het
Grm7 T G 6: 111,057,315 (GRCm39) V305G probably benign Het
Gzma G A 13: 113,237,464 (GRCm39) R8W probably benign Het
H6pd T C 4: 150,066,133 (GRCm39) E759G probably benign Het
Ift27 A G 15: 78,048,391 (GRCm39) V154A probably benign Het
Kif1a A T 1: 92,950,141 (GRCm39) S1429T probably benign Het
Lrrn1 T A 6: 107,546,294 (GRCm39) D697E probably benign Het
Mcrs1 A T 15: 99,141,575 (GRCm39) I387N probably damaging Het
Muc16 T C 9: 18,448,807 (GRCm39) T7675A probably damaging Het
Naf1 GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC 8: 67,313,200 (GRCm39) probably benign Het
Nid1 C A 13: 13,612,416 (GRCm39) L44I possibly damaging Het
Or2f2 A T 6: 42,767,644 (GRCm39) T224S possibly damaging Het
Or4m1 T C 14: 50,558,233 (GRCm39) T20A probably benign Het
Or5h27 A G 16: 59,006,117 (GRCm39) I243T unknown Het
Or8k1 T A 2: 86,047,457 (GRCm39) E199V probably damaging Het
Pde11a C T 2: 75,889,354 (GRCm39) D707N probably damaging Het
Pigf A T 17: 87,327,910 (GRCm39) L119* probably null Het
Pkd1l1 A T 11: 8,820,277 (GRCm39) C1679* probably null Het
Prnp A G 2: 131,778,669 (GRCm39) N107S probably benign Het
Rap2b A G 3: 61,271,805 (GRCm39) probably benign Het
Rtn4 A G 11: 29,657,300 (GRCm39) T485A probably damaging Het
Sec23b A G 2: 144,401,234 (GRCm39) T32A probably benign Het
Skint5 A T 4: 113,437,679 (GRCm39) probably null Het
Slc13a5 A G 11: 72,148,210 (GRCm39) L275P probably damaging Het
Slc20a1 C T 2: 129,041,784 (GRCm39) A49V probably damaging Het
Slc35g2 A G 9: 100,435,224 (GRCm39) I149T probably benign Het
Syk T A 13: 52,778,763 (GRCm39) I283K probably benign Het
Taf7l2 T C 10: 115,948,440 (GRCm39) Y362C probably benign Het
Tnfsf13b G A 8: 10,056,795 (GRCm39) probably benign Het
Ubr1 A G 2: 120,701,476 (GRCm39) V1592A probably benign Het
Vopp1 T C 6: 57,739,379 (GRCm39) *123W probably null Het
Xpo4 T A 14: 57,841,913 (GRCm39) Q467H probably damaging Het
Zdhhc22 A C 12: 87,035,143 (GRCm39) V103G possibly damaging Het
Zfp868 A G 8: 70,064,160 (GRCm39) S392P probably damaging Het
Other mutations in Ptgfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01322:Ptgfr APN 3 151,541,323 (GRCm39) missense probably benign 0.43
IGL02085:Ptgfr APN 3 151,541,437 (GRCm39) missense probably benign 0.00
IGL02110:Ptgfr APN 3 151,541,097 (GRCm39) missense probably damaging 0.97
IGL02971:Ptgfr APN 3 151,540,963 (GRCm39) missense probably benign 0.00
IGL03263:Ptgfr APN 3 151,541,500 (GRCm39) missense probably benign 0.00
R0048:Ptgfr UTSW 3 151,540,728 (GRCm39) missense possibly damaging 0.51
R0048:Ptgfr UTSW 3 151,540,728 (GRCm39) missense possibly damaging 0.51
R0602:Ptgfr UTSW 3 151,540,839 (GRCm39) missense probably damaging 1.00
R0624:Ptgfr UTSW 3 151,540,839 (GRCm39) missense probably damaging 1.00
R0633:Ptgfr UTSW 3 151,507,400 (GRCm39) missense probably benign 0.00
R1614:Ptgfr UTSW 3 151,507,416 (GRCm39) missense probably benign 0.44
R1930:Ptgfr UTSW 3 151,540,831 (GRCm39) missense probably benign 0.16
R1931:Ptgfr UTSW 3 151,540,831 (GRCm39) missense probably benign 0.16
R1989:Ptgfr UTSW 3 151,540,976 (GRCm39) nonsense probably null
R4596:Ptgfr UTSW 3 151,507,430 (GRCm39) missense probably damaging 1.00
R5899:Ptgfr UTSW 3 151,540,738 (GRCm39) missense probably damaging 0.96
R6295:Ptgfr UTSW 3 151,540,926 (GRCm39) missense probably benign 0.00
R6907:Ptgfr UTSW 3 151,540,938 (GRCm39) missense possibly damaging 0.95
R7047:Ptgfr UTSW 3 151,541,178 (GRCm39) missense possibly damaging 0.74
R7320:Ptgfr UTSW 3 151,541,034 (GRCm39) missense probably benign 0.22
R8205:Ptgfr UTSW 3 151,541,418 (GRCm39) missense probably benign 0.04
R9049:Ptgfr UTSW 3 151,541,404 (GRCm39) missense probably benign 0.24
R9352:Ptgfr UTSW 3 151,541,160 (GRCm39) missense probably damaging 1.00
R9537:Ptgfr UTSW 3 151,541,445 (GRCm39) missense possibly damaging 0.91
Z1176:Ptgfr UTSW 3 151,541,278 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTAAGAGTGTGACTCCCGTG -3'
(R):5'- AGACTGGATCCGCTTTGATC -3'

Sequencing Primer
(F):5'- TGACGGCATTGCACGAG -3'
(R):5'- TGATCAGTCAAACATCCTGTGCAG -3'
Posted On 2020-10-20