Incidental Mutation 'R8420:Exph5'
ID653147
Institutional Source Beutler Lab
Gene Symbol Exph5
Ensembl Gene ENSMUSG00000034584
Gene Nameexophilin 5
SynonymsSlac2b, AC079869.22gm5, B130009M24Rik, slac2-b
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8420 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location53301670-53377514 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 53375848 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 1410 (K1410*)
Ref Sequence ENSEMBL: ENSMUSP00000062632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051014]
Predicted Effect probably null
Transcript: ENSMUST00000051014
AA Change: K1410*
SMART Domains Protein: ENSMUSP00000062632
Gene: ENSMUSG00000034584
AA Change: K1410*

DomainStartEndE-ValueType
low complexity region 112 131 N/A INTRINSIC
low complexity region 454 469 N/A INTRINSIC
low complexity region 673 682 N/A INTRINSIC
low complexity region 970 980 N/A INTRINSIC
low complexity region 1556 1568 N/A INTRINSIC
low complexity region 1747 1757 N/A INTRINSIC
low complexity region 1937 1959 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the synaptotagmin-like protein (Slp) family lacking a C2 domain. It contains an N-terminal synaptotagmin-like homology domain (SHD), and is a ras-related protein Rab-27B effector protein. This protein is thought to be involved in exosome secretion and intracellular vesicle trafficking. Reduced expression of this gene results in keratin filament defects. Mutations in this gene have been associated with some cases of epidermolysis bullosa, an inherited skin fragility disorder. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik T C 10: 116,112,535 Y362C probably benign Het
Aatk A G 11: 120,046,920 S11P unknown Het
Adrb2 T C 18: 62,178,933 T274A probably damaging Het
Aph1b A G 9: 66,794,221 S45P probably damaging Het
Atp9b A T 18: 80,844,591 D321E Het
C1qbp A G 11: 70,978,717 V180A possibly damaging Het
C4b G T 17: 34,734,539 A990D probably damaging Het
Ccdc80 T A 16: 45,095,249 S123T possibly damaging Het
Cdh18 A C 15: 23,474,052 E669D possibly damaging Het
Ceacam3 T A 7: 17,161,683 V526D Het
Cenpf C T 1: 189,672,585 C349Y probably damaging Het
Dmrt2 T C 19: 25,678,015 V326A probably damaging Het
Dock9 T C 14: 121,546,042 Q2023R probably damaging Het
Exd2 A G 12: 80,475,997 R77G probably benign Het
Eya2 A G 2: 165,767,068 T443A probably damaging Het
Fam135a G A 1: 24,028,488 T1100M probably benign Het
Foxp2 G T 6: 15,403,867 R381L unknown Het
Grm7 T G 6: 111,080,354 V305G probably benign Het
Gzma G A 13: 113,100,930 R8W probably benign Het
H6pd T C 4: 149,981,676 E759G probably benign Het
Ift27 A G 15: 78,164,191 V154A probably benign Het
Kif1a A T 1: 93,022,419 S1429T probably benign Het
Lrrn1 T A 6: 107,569,333 D697E probably benign Het
Mcrs1 A T 15: 99,243,694 I387N probably damaging Het
Muc16 T C 9: 18,537,511 T7675A probably damaging Het
Naf1 GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC 8: 66,860,548 probably benign Het
Nid1 C A 13: 13,437,831 L44I possibly damaging Het
Olfr1046 T A 2: 86,217,113 E199V probably damaging Het
Olfr197 A G 16: 59,185,754 I243T unknown Het
Olfr452 A T 6: 42,790,710 T224S possibly damaging Het
Olfr734 T C 14: 50,320,776 T20A probably benign Het
Pde11a C T 2: 76,059,010 D707N probably damaging Het
Pigf A T 17: 87,020,482 L119* probably null Het
Pkd1l1 A T 11: 8,870,277 C1679* probably null Het
Prnp A G 2: 131,936,749 N107S probably benign Het
Ptgfr C T 3: 151,835,416 V152M possibly damaging Het
Rap2b A G 3: 61,364,384 probably benign Het
Rtn4 A G 11: 29,707,300 T485A probably damaging Het
Sec23b A G 2: 144,559,314 T32A probably benign Het
Skint5 A T 4: 113,580,482 probably null Het
Slc13a5 A G 11: 72,257,384 L275P probably damaging Het
Slc20a1 C T 2: 129,199,864 A49V probably damaging Het
Slc35g2 A G 9: 100,553,171 I149T probably benign Het
Syk T A 13: 52,624,727 I283K probably benign Het
Tnfsf13b G A 8: 10,006,795 probably benign Het
Ubr1 A G 2: 120,870,995 V1592A probably benign Het
Vopp1 T C 6: 57,762,394 *123W probably null Het
Xpo4 T A 14: 57,604,456 Q467H probably damaging Het
Zdhhc22 A C 12: 86,988,369 V103G possibly damaging Het
Zfp868 A G 8: 69,611,509 S392P probably damaging Het
Other mutations in Exph5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Exph5 APN 9 53376706 nonsense probably null
IGL01387:Exph5 APN 9 53373965 missense possibly damaging 0.95
IGL01985:Exph5 APN 9 53376569 missense probably damaging 0.99
IGL02122:Exph5 APN 9 53373674 missense probably benign 0.05
IGL02156:Exph5 APN 9 53375641 missense probably damaging 0.96
IGL02192:Exph5 APN 9 53376325 nonsense probably null
IGL02491:Exph5 APN 9 53375043 missense possibly damaging 0.89
PIT4802001:Exph5 UTSW 9 53374978 missense probably damaging 0.96
R0002:Exph5 UTSW 9 53373956 missense probably damaging 0.99
R0026:Exph5 UTSW 9 53376479 missense probably benign 0.38
R0086:Exph5 UTSW 9 53337930 missense possibly damaging 0.90
R0152:Exph5 UTSW 9 53353204 critical splice donor site probably null
R0369:Exph5 UTSW 9 53373302 missense probably benign 0.35
R0409:Exph5 UTSW 9 53374343 missense probably benign 0.00
R0517:Exph5 UTSW 9 53372762 missense probably benign 0.02
R0658:Exph5 UTSW 9 53377475 missense unknown
R1606:Exph5 UTSW 9 53374295 missense probably benign 0.37
R1739:Exph5 UTSW 9 53375588 missense possibly damaging 0.62
R1769:Exph5 UTSW 9 53373809 missense probably benign 0.35
R1828:Exph5 UTSW 9 53376641 missense possibly damaging 0.79
R1862:Exph5 UTSW 9 53376248 missense probably benign
R1993:Exph5 UTSW 9 53373635 missense possibly damaging 0.79
R2012:Exph5 UTSW 9 53367166 missense possibly damaging 0.49
R2044:Exph5 UTSW 9 53372679 missense possibly damaging 0.79
R2402:Exph5 UTSW 9 53374925 nonsense probably null
R3817:Exph5 UTSW 9 53375494 nonsense probably null
R4771:Exph5 UTSW 9 53373665 missense possibly damaging 0.95
R4869:Exph5 UTSW 9 53376239 missense possibly damaging 0.73
R4926:Exph5 UTSW 9 53376625 missense possibly damaging 0.95
R4996:Exph5 UTSW 9 53375610 missense possibly damaging 0.79
R5254:Exph5 UTSW 9 53337930 missense probably damaging 0.99
R5522:Exph5 UTSW 9 53374313 missense possibly damaging 0.90
R5947:Exph5 UTSW 9 53375222 missense probably benign 0.04
R5961:Exph5 UTSW 9 53377255 missense probably damaging 1.00
R6093:Exph5 UTSW 9 53372617 missense possibly damaging 0.94
R6144:Exph5 UTSW 9 53373028 missense probably benign 0.21
R6254:Exph5 UTSW 9 53372710 missense possibly damaging 0.81
R6279:Exph5 UTSW 9 53373946 missense possibly damaging 0.78
R6300:Exph5 UTSW 9 53373946 missense possibly damaging 0.78
R6485:Exph5 UTSW 9 53376691 missense possibly damaging 0.89
R6553:Exph5 UTSW 9 53301712 start gained probably benign
R6792:Exph5 UTSW 9 53375317 missense possibly damaging 0.52
R7026:Exph5 UTSW 9 53340428 missense probably benign 0.27
R7340:Exph5 UTSW 9 53377009 missense probably damaging 0.99
R7347:Exph5 UTSW 9 53375896 missense possibly damaging 0.79
R7352:Exph5 UTSW 9 53375722 missense probably benign 0.00
R7520:Exph5 UTSW 9 53367214 critical splice donor site probably null
R7521:Exph5 UTSW 9 53374077 missense possibly damaging 0.89
R7560:Exph5 UTSW 9 53375773 missense probably benign 0.41
R7581:Exph5 UTSW 9 53372557 missense possibly damaging 0.90
R7726:Exph5 UTSW 9 53373175 missense possibly damaging 0.62
R7976:Exph5 UTSW 9 53376635 missense possibly damaging 0.79
R8017:Exph5 UTSW 9 53373452 missense probably benign
R8019:Exph5 UTSW 9 53373452 missense probably benign
R8302:Exph5 UTSW 9 53376476 missense possibly damaging 0.89
X0028:Exph5 UTSW 9 53376263 missense probably damaging 1.00
Z1177:Exph5 UTSW 9 53374213 missense probably benign 0.44
Z1177:Exph5 UTSW 9 53377419 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGACTTCTGTGGGACCAGATG -3'
(R):5'- GTTTCCCTAGGCTGTGACCTAC -3'

Sequencing Primer
(F):5'- GGGACCAGATGTTTCTCTTCATAG -3'
(R):5'- CTAGGCTGTGACCTACTAGAACG -3'
Posted On2020-10-20