Incidental Mutation 'R8420:Slc13a5'
ID653154
Institutional Source Beutler Lab
Gene Symbol Slc13a5
Ensembl Gene ENSMUSG00000020805
Gene Namesolute carrier family 13 (sodium-dependent citrate transporter), member 5
SynonymsIndy, Nact, mINDY, NaC2/NaCT
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8420 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location72241989-72267222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72257384 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 275 (L275P)
Ref Sequence ENSEMBL: ENSMUSP00000021161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021161] [ENSMUST00000137701] [ENSMUST00000140167] [ENSMUST00000208056] [ENSMUST00000208912]
Predicted Effect probably damaging
Transcript: ENSMUST00000021161
AA Change: L275P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021161
Gene: ENSMUSG00000020805
AA Change: L275P

DomainStartEndE-ValueType
Pfam:Na_sulph_symp 8 558 1.3e-121 PFAM
Pfam:CitMHS 13 172 1.6e-14 PFAM
Pfam:CitMHS 202 498 6.4e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000137701
AA Change: L275P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119417
Gene: ENSMUSG00000020805
AA Change: L275P

DomainStartEndE-ValueType
Pfam:Na_sulph_symp 7 115 1.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140167
SMART Domains Protein: ENSMUSP00000119822
Gene: ENSMUSG00000020805

DomainStartEndE-ValueType
Pfam:Na_sulph_symp 6 102 7.9e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000208056
AA Change: L258P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000208912
AA Change: L232P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the solute carrier family 13 group of proteins. This family member is a sodium-dependent citrate cotransporter that may regulate metabolic processes. Mutations in this gene cause early infantile epileptic encephalopathy 25. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a null allele display resistance to diet and age induced obesity, increased energy expenditure, improved glucose tolerance, and increased hepatic lipid oxidation. Mice homozygous for an ENU-induced allele exhibit reduced body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik T C 10: 116,112,535 Y362C probably benign Het
Aatk A G 11: 120,046,920 S11P unknown Het
Adrb2 T C 18: 62,178,933 T274A probably damaging Het
Aph1b A G 9: 66,794,221 S45P probably damaging Het
Atp9b A T 18: 80,844,591 D321E Het
C1qbp A G 11: 70,978,717 V180A possibly damaging Het
C4b G T 17: 34,734,539 A990D probably damaging Het
Ccdc80 T A 16: 45,095,249 S123T possibly damaging Het
Cdh18 A C 15: 23,474,052 E669D possibly damaging Het
Ceacam3 T A 7: 17,161,683 V526D Het
Cenpf C T 1: 189,672,585 C349Y probably damaging Het
Dmrt2 T C 19: 25,678,015 V326A probably damaging Het
Dock9 T C 14: 121,546,042 Q2023R probably damaging Het
Exd2 A G 12: 80,475,997 R77G probably benign Het
Exph5 A T 9: 53,375,848 K1410* probably null Het
Eya2 A G 2: 165,767,068 T443A probably damaging Het
Fam135a G A 1: 24,028,488 T1100M probably benign Het
Foxp2 G T 6: 15,403,867 R381L unknown Het
Grm7 T G 6: 111,080,354 V305G probably benign Het
Gzma G A 13: 113,100,930 R8W probably benign Het
H6pd T C 4: 149,981,676 E759G probably benign Het
Ift27 A G 15: 78,164,191 V154A probably benign Het
Kif1a A T 1: 93,022,419 S1429T probably benign Het
Lrrn1 T A 6: 107,569,333 D697E probably benign Het
Mcrs1 A T 15: 99,243,694 I387N probably damaging Het
Muc16 T C 9: 18,537,511 T7675A probably damaging Het
Naf1 GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC 8: 66,860,548 probably benign Het
Nid1 C A 13: 13,437,831 L44I possibly damaging Het
Olfr1046 T A 2: 86,217,113 E199V probably damaging Het
Olfr197 A G 16: 59,185,754 I243T unknown Het
Olfr452 A T 6: 42,790,710 T224S possibly damaging Het
Olfr734 T C 14: 50,320,776 T20A probably benign Het
Pde11a C T 2: 76,059,010 D707N probably damaging Het
Pigf A T 17: 87,020,482 L119* probably null Het
Pkd1l1 A T 11: 8,870,277 C1679* probably null Het
Prnp A G 2: 131,936,749 N107S probably benign Het
Ptgfr C T 3: 151,835,416 V152M possibly damaging Het
Rap2b A G 3: 61,364,384 probably benign Het
Rtn4 A G 11: 29,707,300 T485A probably damaging Het
Sec23b A G 2: 144,559,314 T32A probably benign Het
Skint5 A T 4: 113,580,482 probably null Het
Slc20a1 C T 2: 129,199,864 A49V probably damaging Het
Slc35g2 A G 9: 100,553,171 I149T probably benign Het
Syk T A 13: 52,624,727 I283K probably benign Het
Tnfsf13b G A 8: 10,006,795 probably benign Het
Ubr1 A G 2: 120,870,995 V1592A probably benign Het
Vopp1 T C 6: 57,762,394 *123W probably null Het
Xpo4 T A 14: 57,604,456 Q467H probably damaging Het
Zdhhc22 A C 12: 86,988,369 V103G possibly damaging Het
Zfp868 A G 8: 69,611,509 S392P probably damaging Het
Other mutations in Slc13a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02347:Slc13a5 APN 11 72258954 splice site probably null
IGL03392:Slc13a5 APN 11 72245178 missense probably damaging 1.00
Punk UTSW 11 72262076 missense probably damaging 1.00
punk2 UTSW 11 72253391 missense possibly damaging 0.65
R0018:Slc13a5 UTSW 11 72266475 missense probably benign
R0018:Slc13a5 UTSW 11 72266475 missense probably benign
R0042:Slc13a5 UTSW 11 72259114 missense probably benign 0.31
R0194:Slc13a5 UTSW 11 72245233 missense probably benign 0.22
R0194:Slc13a5 UTSW 11 72262130 missense possibly damaging 0.95
R0234:Slc13a5 UTSW 11 72250800 missense probably damaging 0.98
R1499:Slc13a5 UTSW 11 72250731 missense probably damaging 0.97
R1655:Slc13a5 UTSW 11 72257378 missense probably benign 0.00
R1728:Slc13a5 UTSW 11 72266459 splice site probably null
R1818:Slc13a5 UTSW 11 72253343 missense probably benign 0.02
R2304:Slc13a5 UTSW 11 72259039 missense probably damaging 1.00
R2352:Slc13a5 UTSW 11 72252321 missense probably benign 0.06
R2408:Slc13a5 UTSW 11 72262076 missense probably damaging 1.00
R2919:Slc13a5 UTSW 11 72247791 missense possibly damaging 0.92
R2920:Slc13a5 UTSW 11 72247791 missense possibly damaging 0.92
R3103:Slc13a5 UTSW 11 72257388 missense probably damaging 1.00
R4772:Slc13a5 UTSW 11 72250846 critical splice acceptor site probably null
R4906:Slc13a5 UTSW 11 72257418 missense probably damaging 0.99
R5385:Slc13a5 UTSW 11 72259077 missense probably benign 0.01
R5562:Slc13a5 UTSW 11 72262039 missense probably damaging 0.99
R5878:Slc13a5 UTSW 11 72253391 missense possibly damaging 0.65
R6173:Slc13a5 UTSW 11 72253197 missense probably benign 0.05
R6665:Slc13a5 UTSW 11 72260360 missense probably damaging 0.99
R7317:Slc13a5 UTSW 11 72245127 missense probably damaging 1.00
R7338:Slc13a5 UTSW 11 72266484 missense probably benign
R7908:Slc13a5 UTSW 11 72259064 missense probably benign 0.00
R8038:Slc13a5 UTSW 11 72253370 missense probably benign 0.31
R8679:Slc13a5 UTSW 11 72259093 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAAGCCTCCAGCCATTGTG -3'
(R):5'- TTATGTGGCCTGCAGTTAGCC -3'

Sequencing Primer
(F):5'- TCCAGCCATTGTGAGACTGAG -3'
(R):5'- GTTAGCCCCATCTCTCAAGAG -3'
Posted On2020-10-20