Incidental Mutation 'R8420:Pigf'
ID653170
Institutional Source Beutler Lab
Gene Symbol Pigf
Ensembl Gene ENSMUSG00000024145
Gene Namephosphatidylinositol glycan anchor biosynthesis, class F
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8420 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location86997256-87025406 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 87020482 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 119 (L119*)
Ref Sequence ENSEMBL: ENSMUSP00000024957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024957]
Predicted Effect probably null
Transcript: ENSMUST00000024957
AA Change: L119*
SMART Domains Protein: ENSMUSP00000024957
Gene: ENSMUSG00000024145
AA Change: L119*

DomainStartEndE-ValueType
Pfam:PIG-F 21 204 1.6e-50 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor, a glycolipid containing three mannose molecules in its core backbone, is found on many blood cells where it serves to anchor proteins to the cell surface. The encoded protein and another GPI synthesis protein, PIGO, function in the transfer of ethanolaminephosphate to the third mannose in GPI. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik T C 10: 116,112,535 Y362C probably benign Het
Aatk A G 11: 120,046,920 S11P unknown Het
Adrb2 T C 18: 62,178,933 T274A probably damaging Het
Aph1b A G 9: 66,794,221 S45P probably damaging Het
Atp9b A T 18: 80,844,591 D321E Het
C1qbp A G 11: 70,978,717 V180A possibly damaging Het
C4b G T 17: 34,734,539 A990D probably damaging Het
Ccdc80 T A 16: 45,095,249 S123T possibly damaging Het
Cdh18 A C 15: 23,474,052 E669D possibly damaging Het
Ceacam3 T A 7: 17,161,683 V526D Het
Cenpf C T 1: 189,672,585 C349Y probably damaging Het
Dmrt2 T C 19: 25,678,015 V326A probably damaging Het
Dock9 T C 14: 121,546,042 Q2023R probably damaging Het
Exd2 A G 12: 80,475,997 R77G probably benign Het
Exph5 A T 9: 53,375,848 K1410* probably null Het
Eya2 A G 2: 165,767,068 T443A probably damaging Het
Fam135a G A 1: 24,028,488 T1100M probably benign Het
Foxp2 G T 6: 15,403,867 R381L unknown Het
Grm7 T G 6: 111,080,354 V305G probably benign Het
Gzma G A 13: 113,100,930 R8W probably benign Het
H6pd T C 4: 149,981,676 E759G probably benign Het
Ift27 A G 15: 78,164,191 V154A probably benign Het
Kif1a A T 1: 93,022,419 S1429T probably benign Het
Lrrn1 T A 6: 107,569,333 D697E probably benign Het
Mcrs1 A T 15: 99,243,694 I387N probably damaging Het
Muc16 T C 9: 18,537,511 T7675A probably damaging Het
Naf1 GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC 8: 66,860,548 probably benign Het
Nid1 C A 13: 13,437,831 L44I possibly damaging Het
Olfr1046 T A 2: 86,217,113 E199V probably damaging Het
Olfr197 A G 16: 59,185,754 I243T unknown Het
Olfr452 A T 6: 42,790,710 T224S possibly damaging Het
Olfr734 T C 14: 50,320,776 T20A probably benign Het
Pde11a C T 2: 76,059,010 D707N probably damaging Het
Pkd1l1 A T 11: 8,870,277 C1679* probably null Het
Prnp A G 2: 131,936,749 N107S probably benign Het
Ptgfr C T 3: 151,835,416 V152M possibly damaging Het
Rap2b A G 3: 61,364,384 probably benign Het
Rtn4 A G 11: 29,707,300 T485A probably damaging Het
Sec23b A G 2: 144,559,314 T32A probably benign Het
Skint5 A T 4: 113,580,482 probably null Het
Slc13a5 A G 11: 72,257,384 L275P probably damaging Het
Slc20a1 C T 2: 129,199,864 A49V probably damaging Het
Slc35g2 A G 9: 100,553,171 I149T probably benign Het
Syk T A 13: 52,624,727 I283K probably benign Het
Tnfsf13b G A 8: 10,006,795 probably benign Het
Ubr1 A G 2: 120,870,995 V1592A probably benign Het
Vopp1 T C 6: 57,762,394 *123W probably null Het
Xpo4 T A 14: 57,604,456 Q467H probably damaging Het
Zdhhc22 A C 12: 86,988,369 V103G possibly damaging Het
Zfp868 A G 8: 69,611,509 S392P probably damaging Het
Other mutations in Pigf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Pigf APN 17 87020448 missense probably null 0.41
IGL01484:Pigf APN 17 87008880 missense probably benign 0.04
R0506:Pigf UTSW 17 87008909 missense probably benign 0.00
R0684:Pigf UTSW 17 87020495 missense probably benign 0.31
R0987:Pigf UTSW 17 86997545 missense probably damaging 1.00
R4295:Pigf UTSW 17 87023756 missense probably benign 0.00
R5365:Pigf UTSW 17 87023708 missense possibly damaging 0.62
R6287:Pigf UTSW 17 86997539 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCTGACATCCCTGAGAGCC -3'
(R):5'- ATCCTTATTTAGTGGGGCTCAG -3'

Sequencing Primer
(F):5'- CTGCCTAGAAACGCTCATAGGATG -3'
(R):5'- ATGTGCACCGCTAAGACT -3'
Posted On2020-10-20