Incidental Mutation 'R8421:4930430A15Rik'
ID 653178
Institutional Source Beutler Lab
Gene Symbol 4930430A15Rik
Ensembl Gene ENSMUSG00000027157
Gene Name RIKEN cDNA 4930430A15 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock # R8421 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 111162061-111229602 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 111218610 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 275 (K275*)
Ref Sequence ENSEMBL: ENSMUSP00000028577 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028577]
AlphaFold Q05AC5
Predicted Effect probably null
Transcript: ENSMUST00000028577
AA Change: K275*
SMART Domains Protein: ENSMUSP00000028577
Gene: ENSMUSG00000027157
AA Change: K275*

DomainStartEndE-ValueType
ANK 78 107 1.61e-4 SMART
ANK 111 140 3.6e-2 SMART
ANK 144 173 4.89e-4 SMART
ANK 177 206 4.03e-5 SMART
ANK 210 239 8.72e-1 SMART
Blast:ANK 243 272 4e-12 BLAST
low complexity region 460 472 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 T C 14: 54,643,029 E1239G unknown Het
Actn3 T C 19: 4,861,713 M806V probably benign Het
Adcy7 A G 8: 88,322,184 T676A probably benign Het
Ankef1 C A 2: 136,537,165 Q12K probably damaging Het
Ankrd40 G T 11: 94,334,836 G231V probably damaging Het
Atad5 T A 11: 80,094,558 V157D probably damaging Het
Atp6v1b1 T A 6: 83,753,809 M163K probably damaging Het
Atp7b A T 8: 22,028,471 M117K probably benign Het
Ccdc87 T C 19: 4,841,285 Y602H possibly damaging Het
Cdh16 C T 8: 104,621,970 R142K probably benign Het
Chrnb3 G A 8: 27,396,690 V431I probably damaging Het
Csf1r A G 18: 61,127,894 D719G probably damaging Het
Ctsll3 A G 13: 60,800,781 F88S probably damaging Het
Dglucy A G 12: 100,842,679 Y212C probably damaging Het
Dnase1l3 T C 14: 7,968,122 D261G possibly damaging Het
Dync2h1 T C 9: 7,102,477 D2641G probably damaging Het
E330021D16Rik T C 6: 136,401,352 E160G probably damaging Het
Fat3 A T 9: 15,998,184 V2174D probably damaging Het
Gtf3c1 A G 7: 125,698,970 L244P probably damaging Het
Hcn4 T A 9: 58,858,096 D620E unknown Het
Ide A G 19: 37,278,004 V800A Het
Ikbkb A T 8: 22,678,788 probably null Het
Lin9 T A 1: 180,665,800 F197Y probably damaging Het
Lrp1b T A 2: 40,725,423 Y3656F Het
Mapkbp1 C A 2: 120,018,950 N708K probably damaging Het
Marveld3 A G 8: 109,948,647 M179T probably benign Het
Mrpl1 C G 5: 96,226,367 A167G probably benign Het
Mrpl35 T C 6: 71,816,167 K167E probably damaging Het
Myo3a T C 2: 22,362,124 V594A probably benign Het
Nav2 A G 7: 49,452,521 T356A probably benign Het
Nup210l A G 3: 90,203,867 Y1692C probably damaging Het
Olfr1054 T A 2: 86,332,903 Y151F possibly damaging Het
Otoa G A 7: 121,099,268 probably null Het
Oxnad1 T G 14: 32,099,474 I172S probably benign Het
Padi4 C A 4: 140,748,222 C544F probably damaging Het
Pard3 A C 8: 127,140,408 probably benign Het
Plvap G A 8: 71,511,532 T62M probably damaging Het
Prdm8 C T 5: 98,185,963 A463V probably damaging Het
Prss21 T A 17: 23,869,368 D102E possibly damaging Het
Psmb10 G T 8: 105,936,710 Q182K probably benign Het
Rasgrf1 C T 9: 89,967,915 P319S probably damaging Het
Rock1 G A 18: 10,072,863 Q1161* probably null Het
Ryr3 T C 2: 112,996,584 E112G probably benign Het
Samm50 A G 15: 84,210,585 T393A probably benign Het
Slc9c1 A G 16: 45,593,371 E954G probably damaging Het
Sulf2 T A 2: 166,117,052 I79F probably benign Het
Tbx21 T C 11: 97,114,735 K135E probably benign Het
Unc13b A G 4: 43,178,304 E3044G unknown Het
Usf3 A T 16: 44,217,209 Q684L possibly damaging Het
Vmn1r114 A T 7: 20,811,534 M218K possibly damaging Het
Vmn1r203 T G 13: 22,524,984 *312G probably null Het
Vmn2r67 A C 7: 85,136,685 L704R probably damaging Het
Zfp618 A G 4: 63,133,246 T755A probably damaging Het
Zp3 A G 5: 135,988,477 T381A probably benign Het
Zscan20 T C 4: 128,585,827 D957G probably damaging Het
Other mutations in 4930430A15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:4930430A15Rik APN 2 111220762 missense probably damaging 0.98
IGL01403:4930430A15Rik APN 2 111229170 unclassified probably benign
IGL01431:4930430A15Rik APN 2 111225395 unclassified probably benign
IGL01601:4930430A15Rik APN 2 111193478 missense unknown
IGL01649:4930430A15Rik APN 2 111214576 splice site probably benign
IGL02355:4930430A15Rik APN 2 111211651 splice site probably benign
IGL02362:4930430A15Rik APN 2 111211651 splice site probably benign
IGL02485:4930430A15Rik APN 2 111228325 missense probably damaging 0.97
IGL02620:4930430A15Rik APN 2 111211625 missense probably benign 0.00
IGL03156:4930430A15Rik APN 2 111200412 missense possibly damaging 0.90
IGL02980:4930430A15Rik UTSW 2 111164473 missense unknown
R0577:4930430A15Rik UTSW 2 111194349 missense probably benign 0.27
R0638:4930430A15Rik UTSW 2 111200418 missense probably damaging 0.96
R0645:4930430A15Rik UTSW 2 111214583 critical splice donor site probably null
R0671:4930430A15Rik UTSW 2 111204137 missense possibly damaging 0.93
R0829:4930430A15Rik UTSW 2 111198105 missense possibly damaging 0.92
R1464:4930430A15Rik UTSW 2 111225403 critical splice donor site probably null
R1464:4930430A15Rik UTSW 2 111225403 critical splice donor site probably null
R1486:4930430A15Rik UTSW 2 111200358 missense possibly damaging 0.84
R1509:4930430A15Rik UTSW 2 111218627 missense probably benign
R1672:4930430A15Rik UTSW 2 111220774 missense probably benign 0.00
R2073:4930430A15Rik UTSW 2 111200418 missense probably damaging 0.96
R2074:4930430A15Rik UTSW 2 111200418 missense probably damaging 0.96
R2075:4930430A15Rik UTSW 2 111200418 missense probably damaging 0.96
R2899:4930430A15Rik UTSW 2 111220670 splice site probably benign
R2965:4930430A15Rik UTSW 2 111204019 missense possibly damaging 0.61
R3110:4930430A15Rik UTSW 2 111228054 missense probably damaging 1.00
R3112:4930430A15Rik UTSW 2 111228054 missense probably damaging 1.00
R4489:4930430A15Rik UTSW 2 111220702 missense probably benign 0.31
R4821:4930430A15Rik UTSW 2 111204145 critical splice acceptor site probably null
R4925:4930430A15Rik UTSW 2 111218616 missense probably benign 0.41
R5045:4930430A15Rik UTSW 2 111193459 missense unknown
R5057:4930430A15Rik UTSW 2 111225421 missense probably benign 0.12
R5128:4930430A15Rik UTSW 2 111164329 nonsense probably null
R5250:4930430A15Rik UTSW 2 111228077 missense possibly damaging 0.87
R5333:4930430A15Rik UTSW 2 111194337 missense possibly damaging 0.92
R5376:4930430A15Rik UTSW 2 111215599 missense probably benign 0.44
R5677:4930430A15Rik UTSW 2 111211565 missense probably benign
R5722:4930430A15Rik UTSW 2 111204123 missense probably benign
R5735:4930430A15Rik UTSW 2 111225492 nonsense probably null
R6170:4930430A15Rik UTSW 2 111227948 missense probably benign 0.03
R6366:4930430A15Rik UTSW 2 111169592 critical splice donor site probably null
R6496:4930430A15Rik UTSW 2 111164472 missense unknown
R6654:4930430A15Rik UTSW 2 111171884 missense unknown
R6983:4930430A15Rik UTSW 2 111228250 critical splice donor site probably null
R7371:4930430A15Rik UTSW 2 111193481 missense unknown
R7958:4930430A15Rik UTSW 2 111170325 missense unknown
R8495:4930430A15Rik UTSW 2 111229410 start codon destroyed probably null 0.33
R8534:4930430A15Rik UTSW 2 111228035 missense possibly damaging 0.92
R8671:4930430A15Rik UTSW 2 111229532 unclassified probably benign
R8679:4930430A15Rik UTSW 2 111229222 missense possibly damaging 0.73
R8743:4930430A15Rik UTSW 2 111169672 missense unknown
R8983:4930430A15Rik UTSW 2 111200356 missense probably benign 0.00
R9213:4930430A15Rik UTSW 2 111190354 missense unknown
R9457:4930430A15Rik UTSW 2 111170286 missense unknown
R9723:4930430A15Rik UTSW 2 111228355 missense probably damaging 0.97
R9745:4930430A15Rik UTSW 2 111169663 missense unknown
Predicted Primers PCR Primer
(F):5'- GACAGCTTTGGTGAGTGATAAC -3'
(R):5'- AGGATTTCATGATTTCTGGACAGC -3'

Sequencing Primer
(F):5'- CAGCTTTGGTGAGTGATAACAAAATC -3'
(R):5'- AGTGGAAGAAAATAACACATTGGG -3'
Posted On 2020-10-20